Skip to main content

Table 1 Primers for validation of differentially expressed murine and human genes

From: HMGA1 drives stem cell, inflammatory pathway, and cell cycle progression genes during lymphoid tumorigenesis

Gene Forward Primer Reverser Primer RefSeq ID
Mouse Primers    
Bub1b TAGTGGCTTTCGGACTGCACAGAT AGACATGGAGGTGCTCCTTGAACA [NCBI:NM_009773.3]
Cd8b1 CTGCTTTGAACTGCTGCAAGCTCT TGGGAGTTCTTGGTTCTTCAGCCA [NCBI:NM_009858.2]
Cxcr3 AACTCAGCCATCCCTGTGTGAGAA ATGGGCACATTCAGTGCTGACAAC [NCBI:NM_009910.2]
Eomes AGGTCGTTCAAGGTGCTGGATTGA TAATAGCACCGGGCACTCGTTCTT [NCBI:NM001 164789.1]
Foxp1 ACTCTGTGCATTGGATGGACCTGT AAGCTGCAGTTCAAAGTCTGCTGC [NCBI:NM001197321.1]
Gzmm ACCTTCTACATCCGGGAAGCCATT GTGGTTTGACATTCTTGCTGGGCT [NCBI:NM_008504.2]
Il18r1 ATCCTGAAGGATGCCGAGTTTGGA TGGTGATGTTGTACCGTGTCCCAT [NCBI:NM001161842.1]
Il2rb TTTCTGGCTTCTTCTCCTGCGTCT AAGGATCTGGGATGTGGCACTTGA [NCBI:NM008368.4]
Human Primers    
BUB1B TGGGATGGGTCCTTCTGGAAACTT CACTGTGGCCTCATCATTGGCATT [NCBI:NM001211.5]
CD8B1 ACCTCACAGAAGCTGCTTAACCCA TGAGCGAGGGAGGAATCTGGTAAA [NCBI:NM001178100.1]
CXCR3 ACATAGTTCATGCCACCCAGCTCT TGGGAAGTTGTATTGGCAGTGGGT [NCBI:NM001142797.1]
EOMES CAAATTCCACCGCCACCAAACTGA TTGTAGTGGGCAGTGGGATTGAGT [NCBI:NM_005442.2]
FOXP1 AAACATTTCGGCAATGGTGAGGGC TGCATAATGCCACAGGACTGCAAC [NCBI:NM_001012505.1]
GZMM GTCTGCACTGACATCTTCAAGCCT ATTTATTGGTCCCTCCCTGTCCCT [NCBI:NM005317.2]
IL18R1 CTCCAGAAGGCAAATGGCATGCTT ATTCCTCTTAAGACGTGGCCT [NCBI:NM003855.2]
IL2RB TCCCAAGCCTCCCACTACTTTGAA TGACCCGCACCTGAAACTCATACT [NCBI:NM_000878.2]