Skip to main content

Table 5 Primers used in this study.

From: Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus

Name Sequence of primers (5'→3')
Cystatin-PF GTGATGAGGTAAAGCCCAGTGCGGAG
Cystatin-PR TGGCAGTGGTTTGAAAACACGGAGGT
CCL18-PF TGCTTTCCTCAGTGATCTGCCAG
CCL18-PR AGATGCGACGACCCTTTTTTGAA
CCR4-PF ACAACAGCCAAGCCACAGGAAGC
CCR4-PR CAGGTGAAAAAACAAACAATGAA
IL8-PF GTGTCAACCCAGTGCTGTATGCCTT
IL8-PR TTCAAAGTGTCTCTCTGGTCGTCTC
IIGP1-PF ACCACCTTAGAGGCTACACCATACCCC
IIGP1-PR TCTCCTGAGCGAGTTTCACATCATTTT
GILT-PF TGTTCCTAACTGAGATGCTCTTCCCC
GILT-PR ATGTTGCCCTGACATTCTGGTGGTC
g-lysozyme-PF CCTATAATACCTACGGGCTGATG
g-lysozyme-PR TAGGCTGCTATCCCACCTTTCA
TFIID-PF CCAGGAGGATGAGGAGGAGGAG
TFIID-PR GCTGTATGGAGGAGAAAGGGTT