Skip to main content

Table 5 Primers used for qRT-PCR

From: Genome-wide differential gene expression in immortalized DF-1 chicken embryo fibroblast cell line

Accession # Forward Primer (5' → 3')
Reverse Primer (5' → 3')
Gene Symbol
AB109635 GGCACCAACTTGCTACCACA
GCTGCAAGAGCTGCCATTAG
HMGCR
AB196971 AGTGATGGGCGGAACAGAGT
GTCTTGCTGCACACCGACTT
APCDD1
AF505881 CCAGCTACATCTCCCACCTG
TCTGTTTGGGCTGGGAGTTC
SCX
AJ131110 GTGGATAGCTTGGGGACCAG
AAGACTGGGAGCTGGGACTG
TWIST2
BU279212 GGCAACCATTTTGATCTTGCT
CCCCTGCAAAAGCTGAAATC
CBLN2
BX929635 TCTCGCTCCTGGCAATGATA
CCAGCAGCACCATCTTTGAG
NDP
BX931599 CTGTTTCCTGACCGCAGTTC
AGCACAAACTCCGCCATTTT
VIPR2
BX932694 GGCCCCTTACTGGTGGTCTT
AGACGGGCTTTGGATAGCAA
MPZL2
BX933478 CCTGTGCAAGGTGTCCAGTG
CCCAATGGCCATACAGTTCA
MXRA5
BX933888 CTGGGATCCCTCCAGAGCTA
CCATTCACTGGAGCACCAAA
C1QTNF3
BX935456 CGAGGCCATCAACTTCCTTC
TCCACATGACGCACATACCC
EGLN3
BX936211 CCAGCTGTCCTCCTTGGAAT
AGGGAGAGGAAGACGTGCTG
TMEM116
CK611983 ATGATGACTGGGGGCTTGTC
GCAACCACTTGAGTCCGGTA
CSTA
CR385566 CGCGCTCTACGACTACATGC
CTGGGTGGTGATCTCGGTCT
CLEC3B
D87992 TGCAGCACTGAGACCTGGAT
CAGTTGCTGCGGATGAAGTC
ANPEP
M60853 TTTTGGCTACCAGTCCAGCA
TTCGCAAGTGTTCCCCAGTA
THBS2
M64990 TGCTCCCCTGAGTACTGGAA
GCCTCTGTGGGTTCAGGATT
PTGS2
M80584 TCCCACTGAGCAGCTTCTGTA
CCAGAGAGATATCCGCAGCA
LUM
M87294 GGTGCTGACTTTCGCCTTGT
GCCTGGTGATGAGGTTGATG
NPY
X87609 CCACCTGAGAAAAGCGACCT
ACATCGACCTCTGCCAACCT
FST
NM_204305 GGCACTGTCAAGGCTGAGAA
TGCATCTGCCCATTTGATGT
chGAPDH
  1. The first column indicates the NCBI accession number for designated genes, and the second column shows sequences for the forward and reverse primers. The gene symbols are provided in the third column.