Skip to main content

Table 3 Real time PCR primers used for expression validations of selected enzymes.

From: De novo assembly of Euphorbia fischeriana root transcriptome identifies prostratin pathway related genes

Accession Enzyme 5'-Forward Primer Sequence-3' 5'-Reverse Primer Sequence-3'
EFI_002990 AACT-1 ACTATGCTTGCAGCCCAAAG ATTTCCCATGCCAACATCAT
EFI_012483 AACT-2 ACAATGCTTGCTGCACAGAC TCTCCACAAACTCCCATTCC
EFI_015339 CS-1 GGAGAGCTATTTTTGGGCAGT CGACTTGAGCAAATGAGTCGT
EFI_018002 CS-2 GCAATTGATCCATCAGCAAG AAGCAAAACAACTCTGGCAAT
EFI_007143 DXS-1 CGCACTAAATTTTGGGTTGC CAAATCCCTTGGAATTGGTG
EFI_010574 DXS-2 GCTGCAAAAAGCATCACAAA GGAGCTGGCATTGCTTTTAC
EFI_003135 DXS-3 TTTGCAACAAGTGGCATCTC ATAGCCAAAGCCTCCACAAA
EFI_010535 GGPPS-1 CAAAAAGCTTCGCAATTCCT GATTTTTGCGGGTTCTCTGA
EFI_010585 GGPPS-2 ACTTGCAGCCGTTTGTTTCT ATCAGCAACGAGGGAAAATG
EFI_008533 GGPPS-3 ATTGTTAGCGGGTGCTGAAG CAGCTCTTCCGCCATTTCTA
EFI_016937 GGPPS TCAATTCGCTGTTCTGCTTC CCCTTAGAAAGGGCGGAGTA
EFI_001905 IDS/HDR CCACAGACGACTCTGCTTCA GGTGTGCTCATTCCCATTTT
EFI_000087 HDS GTTTGGGCGATACAATCAGG ATCCACCTCTTCACCCTCCT
EFI_0 00846 HMGR-1 CTCCACCGCAAAACCTCTTA AACGACATGGAGAGGAGTGG
EFI_011656 HMGR-2 CAGTGCTGTGAAATGCCTGT AGCTCTTGTCATGCCATCCT
EFI_001179 MDD GAGACATGGGTGAGGATGGT CCTCCCCATTAAGCCACATA
EFI_014705 Actin-1 GGGAACGAGTCCCTGGTAGT CTGCGTTGGTGGTCTTACCT
EFI_006680 Actin-2 AAATATGGCCGACAGTGAGG ATACCTCGCTTGGACTGAGC
EFI_000139 α-tubulin GGCAACTTTTCCATCCTGAG TCCAAGACCAGAACCAGTCC
EFI_014153 β-tubulin-1 AAGCAGGTCAATGTGGGAAC CATTGTCCCTGGTTCAAGGT
EFI_014578 β-tubulin-2 GCTTGCAAGGTTTCCAGGTA TTTTCCACAAGCTGATGCAC