Skip to main content

Table 2 Differentially expressed miRNAs of zebrafish brain under cold-acclimated and normal conditions.

From: MicroRNA-mediated gene regulation plays a minor role in the transcriptomic plasticity of cold-acclimated Zebrafish brain tissue

miRNA name Genome coordinate miRNA sequence # WC # NC Fold
dre-mir-9-5-3p 5:49144568:49144646:- UAAAGCUAGAUAACCGAAAGU 37364 2559 7.377 (↑)
dre-mir-30d-5p 16:23860143:23860227:+ UGUAAACAUCCCCGACUGGAAGCU 19903 3770 2.667 (↑)
miR_49 4:52193679:52193757:+ UUCACUGUGGCGGAAAUGACC 146 31 2.380 (↑)
miR_46 21:25385786:25385876:+ AAGAGAAGAGUGAGCGAGUGA 149 32 2.352 (↑)
dre-mir-30e-2-5p 13:28550257:28550337:+ UGUAAACAUCCUUGACUGGAAGC 2856 617 2.339 (↑)
dre-mir-24-4-3p 22:5036700:5036779:+ UGGCUCAGUUCAGCAGGAACAG 652 142 2.320 (↑)
dre-mir-2191-3p 20:51108008:51108091:+ UCACACCUACAAUCCCUGGCA 435 99 2.221 (↑)
dre-mir-146a-5p 13:11738901:11738980:+ UGAGAACUGAAUUCCAUAGAUGG 42728 10063 2.145 (↑)
miR_48 24:36888097:36888173:+ UGAGGAGUUUAGAGCAAGUAA 129 31 2.102 (↑)
miR_23 5:8733083:8733158:- AGCUGGUGUCCUGCAGAGUUU 345 85 2.051 (↑)
dre-mir-455-5p 5:66430757:66430834:- UAUGUGCCCUUGGACUACAUC 168 42 2.021 (↑)
dre-mir-30b-3p 16:23860432:23860510:+ CUGGGCGGAGGGUGUUUGCU 456 462 2.006 (↓)
dre-mir-145-5p 14:40451735:40451816:+ GUCCAGUUUUCCCAGGAAUCCC 104 106 2.017 (↓)
dre-mir-129-1-3p 4:18861279:18861364:- AAGCCCUUACCCCAAAAAGUAU 643 697 2.145 (↓)
dre-mir-133a-2-3p 23:5570884:5570961:- UUGGUCCCCUUCAACCAGCU 117 130 2.199 (↓)
miR_13 5:6754333:6754409:+ UGUGGUGAUUAGAACAGGCUGA 159 181 2.253 (↓)
miR_3 Zv8_NA10078:51197:51280:- AUGACUCAAACCCGAGGACUU 1279 1618 2.504 (↓)
dre-mir-92a-1-3p 8:45338553:45338629:+ UAUUGCACUUGUCCCGGCCU 9007 11736 2.579 (↓)
dre-mir-458-3p 14:26650559:26650634:- AUAGCUCUUUGAAUGGUACU 17139 22528 2.601 (↓)
dre-mir-129-2-3p 7:50935695:50935777:- AAGCCCUUACCCCAAAAAGCAU 7747 10824 2.766 (↓)
dre-mir-152-3p 3:21062159:21062235:+ UCAGUGCAUGACAGAACUUUG 2271 3467 3.021 (↓)
dre-mir-183-5p 4:14884980:14885059:+ UAUGGCACUGGUAGAAUUCACU 182 303 3.294 (↓)
miR_5 Zv8_NA3780:11797:11893:+ GCAUUGGUGGUUCAGUGGGA 698 1247 3.536 (↓)
dre-mir-182-5p 4:14886067:14886150:+ UUUGGCAAUGGUAGAACUCACA 151 365 4.783 (↓)
miR_8 2:35918353:35918422:+ AGCGGAUCAACUGAUGCGAC 98 394 7.956 (↓)
  1. #WC: the number of miRNAs in the cold library; #NC: the number of miRNAs in the normal library; Fold: normalized fold change of miRNAs in the normal over the cold library. ↑(↓) denotes the up(down)-regulation.