Skip to main content

Table 3 Quantitative PCR Gene and Primer Information.

From: Generation of a reference transcriptome for evaluating rainbow trout responses to various stressors

Gene Gene Symbol Primer Sequences Amplicon Size
(bp)
Caspase 3 casp3 TTTGGGAGTAGATTGCAGGG
TGCACATCCACGATTTGATT
52
Caspase 8 casp8 CAGCATAGAGAAGCAAGGGG
TGACTGAGGGGAGCTGAGTT
93
P53 p53 GTGGAATTTGATCCGAGTCTGT
AGTGTCCAGGGTAGAAATGGAG
78
Nuclear protein 1 nupr1 CGAAGAAGCACACTACGATCAA
TCAGTCCGATTTCTCTCTTGGT
98
Heat shock    167
protein 70 b hsp70b AGGCCCAACCATTGAAGAGA
GCAATGTCCAGCAATGCAATA
 
NaKATPalpha1a nakatpa1a GTGACGGTGAGAAGAAGAACATC
GGCAGAGACGATACGCAAAT
107
NaKATPalpha1b nakatpa1b GTCTTCCTGGGCGTGTCTTT
CTCTGGCACATTAGCAACGAT
105
NaKATPalpha1c nakatpa1c ATCGTGACTGGTGTTGAAGAAG
GAAGAAGAGGAAGGGTGTGATTTC
108
NaKATPalpha3 nakatpa3 GGCATCACCTTCTTCATCCT
ACAGTAGCCAGTAAGCCCTCAG
113
β-actin Bact GCCGGCCGCGACCTCACAGACTAC
CGGCCGTGGTGGTGAAGCTGTAAC
73
Elongation factor    95
1f1a CATTGACAAGAGAACCATTGA
CCTTCAGCTTGTCCAGCAC