Skip to main content

Table 1 Primer sequences used in quantitative qRT-PCR analyses

From: Obesity resistant mechanisms in the Lean polygenic mouse model as indicated by liver transcriptome and expression of selected genes in skeletal muscle

Gene name Gene symbol Sense primer
(5'-3')
Antisense primer
(5'-3')
3-hydroxy-3-methylglutaryl-Coenzyme A reductase Hmgcr 1 cttgtggaatgccttgtgattg agccgaagcagcacatgat
Low density lipoprotein receptor Ldlr 1 aggctgtgggctccatagg tgcggtccagggtcatct
Insulin induced gene 1 Insig1 2 tcacagtgactgagcttcagca tcatcttcatcacacccaggac
Peroxisome proliferator activated receptor α Ppara 3 cctcttcccaaagctccttca cgtcggactcggtcttcttg
Deiodinase iodothyronine type II Dio2 4 Mm00515664_m1
Interleukin-6 Il6 4 Mm00446190_m1
Glucose-6 phosphatase G6Pc 4 Mm00839363_m1
18 S ribosomal RNA 18S 5 cgccgctagaggtgaaattc ttggcaaatgctttcgctc
β-actin Actb ccgtgaaaagatgacccagatc cacagcctggatggctacgt
  1. 1 Reference [41]; 2 Reference [42]; 3 Reference [43] ; 4 Assay-on-demand (Applied Biosystems) 5 Reference [44]