Obesity resistant mechanisms in the Lean polygenic mouse model as indicated by liver transcriptome and expression of selected genes in skeletal muscle

Table 1 Primer sequences used in quantitative qRT-PCR analyses

Gene name	Gene symbol	Sense primer (5'-3')	Antisense primer (5'-3')
3-hydroxy-3-methylglutaryl-Coenzyme A reductase	Hmgcr ¹	cttgtggaatgccttgtgattg	agccgaagcagcacatgat
Low density lipoprotein receptor	Ldlr ¹	aggctgtgggctccatagg	tgcggtccagggtcatct
Insulin induced gene 1	Insig1 ²	tcacagtgactgagcttcagca	tcatcttcatcacacccaggac
Peroxisome proliferator activated receptor α	Ppara ³	cctcttcccaaagctccttca	cgtcggactcggtcttcttg
Deiodinase iodothyronine type II	Dio2 ⁴	Mm00515664_m1
Interleukin-6	Il6 ⁴	Mm00446190_m1
Glucose-6 phosphatase	G6Pc ⁴	Mm00839363_m1
18 S ribosomal RNA	18S ⁵	cgccgctagaggtgaaattc	ttggcaaatgctttcgctc
β-actin	Actb	ccgtgaaaagatgacccagatc	cacagcctggatggctacgt

¹ Reference [41]; ² Reference [42]; ³ Reference [43] ; ⁴ Assay-on-demand (Applied Biosystems) ⁵ Reference [44]

ISSN: 1471-2164