Skip to main content

Advertisement

Table 1 Consensus sequences for periodicity 21 nt.

From: Origin of multiple periodicities in the Fourier power spectra of the Plasmodium falciparum genome

Chromosome Relative Position Consensus sequence Repetitions
1 0.0179–0.0383 CTTAACTAACATAGG TCTTAA 622.8
  0.965–0.997 AGTTAGTTAAGTTAAGACC TA 994.3
2 0.0146–0.0223 ACTAACTTAGG TCTTAACTTA 348.2
  0.981-0.986 TTAGTTAAGTTAAGACC TAA 264.3
3 0.0126–0.0236 GG TCTTACTTCACTAACATA 552.2
  0.0157–0.0234 ATAGG TCTTAACTTAACTAAC 417.6
  0.0121–0.0283 TAGG TCTTAATTAACTAACT 817.5
  0.986–0.988 TAAGACC TAAGTTAGTGAAGT 78.6
4 0.0139–0.0221 AGG TCTTACTTCACTAACTT 472.4
  0.986–0.991 TTAGTTAAGTTAAGACC TAAG 238.2
5 0.0087–0.0129 ACTAACATAGG TCTTACTTC 269.8
6 0.977–0.979 TAAGACC TATGTTAGTAAAG 152.7
  0.982-0.990 AAAGTTAAGACC TAAGTTAGT 581.6
7 0.991–0.999 TTAAGACC TAAGTTAGTGAAG 543.8
8 0.0077–0.0119 ACTAGG TCTTAACTTAACTA 269.6
  0.988–0.991 AAGACC TAAGTTAGTAAGTT 185.4
9 0.978–0.985 GACC TATGTTAGTAAAGTAA 551.6
  0.987–0.993 TAAGACC TAAGTTAGTGAAG 413.4
10 0.0073–0.0116 TAGG TCTTACTTTAACTAACT 344.4
  0.981–0.990 GACC TATATTAGTTAAGTTAA 737.5
11 0.0072–0.0093 TTACTAACATAGG TCTTAAC 202.3
12 0.0049–0.0055 TAACTTAGG TCTTAACTTCAC 67.5
  0.991–0.995 TATGTTAGTTAAGTTAAGACC 354.0
13 0.0049–0.0069 ACTAACATAGG TCTTACTTC 269.8
  0.990–0.991 AGTAAGACC TTAGTTAGTGA 192.5
  0.991-0.993 GACC TATGTTAGTGAAGTTAA 345.2
  1. Main tandem repetitions of periodicity 21 nt found in the P. falciparum genome, except for chromosome 14 from which no such periodicities were detected. Some consensus sequences provided by Tandem Repeats Finder [28] are of size 20 nt, yet they all correspond to the periodicity of 21 nt.