Skip to main content

Table 5 Primers used for the validation of gene expression and alternative splicing

From: RNA-Seq analysis uncovers transcriptomic variations between morphologically similar in vivo- and in vitro-derived bovine blastocysts

Gene Primer sequence 5'→3' Amplicon size (bp)
Primers for gene expression validation
GBG5 F: TCCAGCGTCGCGGCTATGAA 94
  R: TCAAATCTGCAGCTGCCTGGGA  
PGP F: TGAAGCGGCTGGGCTTCCCTAT 131
  R: GGGCACCAACATGGACAACCGA  
QOP5F6 F: TGGTGACGTGCACCCGAATGA 112
  R: AGCACCCACGATGGGGAAGATC  
CFL1 F: TGGTGTCGACGACTTACGCACT 132
  R: AGCGCCTCTCGTCTTGTAGGCT  
B4GALT4 F: TGATACCGGCCTCTGTGCACCT 113
  R: TGCCCTTCTGTGTCTCCACACCT  
MYL7 F: ACCCCAGTGGTAAAGGCGTGGT 115
  R: TCCATGGGTGTCAGGGCGAACA  
DUS6 F: GGGCGAACTCGGCTTGGAACTT 118
  R: AACGAGAATACGGGCGGCGA  
Primers for alternative splicing validation
AP2B1-F1 GCCTAGATAGTCTGCTTGGCA 134
AP2B1-R ACCACTGCTGACCACAGC  
AP2B1-F2 GCCTAGATAGTCTGGTGGGA 92
AP2B1-R ACCACTGCTGACCACAGC  
ZDHHC16-F1 TGCTGCCATCGAGACTTA 97
ZDHHC16-R GCACAGGAACCAGAGGTAGAC  
ZDHHC16-F2 CGACAAGAACAAACTACAGG 118
ZDHHC16-R GCACAGGAACCAGAGGTAGAC