Skip to main content

Table 1 Conserved miRNAs identified in P.densata

From: Transcriptome-wide identification and characterization of miRNAs from Pinus densata

miRNA gene miRNA sequence (5'-3') Arm Length (nt) A + U (%) Folding energy MFEI RT-PCR qPCR *Conserved in other plants
          ath osa ptc vvi pta pab
pde-miR159a UUUGGUUUGAAGGGAGCUCUAa 3' 21 53.5 -94.74 0.89 + + + + + + +  
pde-miR162a UCGAUAAACCUCUGCAUCCAG 3' 21 45.0 -49.10 0.80    ++ + ++ ++   
pde-miR166a UCGGACCAGGCUUCAUUCC 3' 19 45.8 -49.10 0.96 + + + + + ++ + +
pde-miR166b UCGGACCAGGCUUCAUUCC 3' 19 48.8 -43.40 1.01 + + + + + ++ + +
pde-miR169a CAGCCAAGGAUGACUUGCCUAa 5' 21 58.3 -48.80 1.14 +   + + + +   
pde-miR171a UGAUUGAGCCGUGCCAAUAUC 3' 21 55.2 -55.20 1.28 + + + ++ ++ ++ +  
pde-miR390a AAGCCCAGGAUGGAUAGCGCC 5' 21 53.7 -40.50 0.92   + + + + + ++  
pde-miR396a UCCCACGGCUUUCUUGAACUUa 5' 21 55.1 -43.28 0.90    + + + + + +
pde-miR482a UCUUUCCUACUCCUCCCAUUCC 3' 22 52.3 -60.90 0.98 + + +   + ++ + ++
pde-miR482b UCUUCCCUAUUCCUCCCAUUCC 3' 22 52.1 -60.30 1.04 +   +   + + + ++
pde-miR482c GGCUUGCGAGGGUAGGAAAAGa 5' 21 48.9 -45.20 0.90    +   + + + +
pde-miR482d CCUUUCCAACGCCUCCCAUGCCa 3' 22 54.8 -46.50 0.76 +   +   + + + +
pde-miR783 AUUCUUUGCUGGUUCAUUUUC 3' 21 57.0 -26.80 0.67 +       +  
pde-miR946a CAGCCCUUCUCCUAUCCACAA 3' 21 59.3 -71.50 1.02 + +      ++  
pde-miR947 CAUCGGAAUCUGUUACUGUUUC 3' 22 48.7 -70.70 0.94 +       ++ +
pde-miR949a UCUCUAGGAAUCAAAUGUGUCa 5' 21 47.7 -41.80 0.91 +       +  
pde-miR949b UCUCCGGGAAUCCAAUGCGCC 5' 21 46.3 -66.30 1.12 +       ++  
pde-miR950a UCUGGUCCACGGUGGUUUAUa 5' 20 57.2 -40.90 1.05 + +      + +
pde-miR951 UGUUCUUGACGUCUGGACCAC 5' 21 54.8 -43.00 0.83 +       ++ +
pde-miR952a AACAGAGCAUGCCAUUGGUGa 5' 20 54.0 -232.79 0.96 +       ++  
pde-miR952b AACAGAGCAUGCCAUUGGUGa 5' 20 53.9 -214.40 0.99 +       ++  
pde-miR952c AACAGAACAUGCCAUUGGUGa 5' 20 54.2 -192.12 0.90 +       ++  
pde-miR1310 GGCAUCGGGGGCGUAACGCCCU 5' 22 47.0 -35.00 0.80 +       ++  
pde-miR1311 UCAGAGUUUUGCCAGUUCCGCC 3' 22 48.8 -43.40 0.99 + +      ++ ++
pde-miR1312a UUUGGAGAGAAAAUGGCGACAU 3' 22 62.8 -41.50 0.81 +       ++  
pde-miR1313 UACCACUGAAAUUGUUGUUCGa 5' 21 58.6 -66.72 0.71 + +      +  
pde-miR1314a CCGGCCUCGAAUGUUAGGAGAAa 3' 22 56.2 -42.30 0.92 + +      +  
pde-miR1448 CUUUCCAACGCCUCCCAUGCa 3' 20 54.8 -46.50 0.76 +     +    
pde-miR2118a UUUCCAACGCCUCCCAUGCCUAa 3' 22 54.8 -46.50 0.76 +    +     
pde-miR2118b UUCCCUAUUCCUCCCAUUCCUAa 3' 22 49.4 -42.00 0.98 +    +     
pde-miR3701 UGAACAAUGCCCACCCUUCAUCa 3' 22 59.3 -84.10 1.07 +        +
pde-miR3704a GGUCUCGGUGGAGUUGGGAAGAa 5' 22 53.8 -49.00 0.98 +        +
pde-miR3704b GGUCUCGAUGGAGUUGGGAAGAa 5' 22 54.7 -46.40 0.95 +        +
pde-miR3712 UGUGAUCAAGAUCAGACUCCCAa 5' 22 59.4 -15.00 0.54 +        +
       0.92
± 0.15b
        
  1. *Ath, osa, ptc, vvi, pta and pab are the abbreviations for A. thaliana, O. sativa, P. trichocarpa, Vitis vinifera, P. taeda and P. abies, respectively. The plus symbols indicate: ++, miRNAs identical to known miRNAs in other plant species; +, miRNAs homologous to known miRNAs in other plant species. a is a novel member of corresponding miRNA family. b 0.92 ± 0.15 is the average and standard deviation of MFEI values of pre-miRNAs.