From: Transcriptome-wide identification and characterization of miRNAs from Pinus densata
miRNA gene | miRNA sequence (5'-3') | Arm | Length (nt) | A + U (%) | Folding energy | MFEI | RT-PCR | qPCR | *Conserved in other plants | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ath | osa | ptc | vvi | pta | pab | |||||||||
pde-miR159a | UUUGGUUUGAAGGGAGCUCUAa | 3' | 21 | 53.5 | -94.74 | 0.89 | + | + | + | + | + | + | + | |
pde-miR162a | UCGAUAAACCUCUGCAUCCAG | 3' | 21 | 45.0 | -49.10 | 0.80 | ++ | + | ++ | ++ | ||||
pde-miR166a | UCGGACCAGGCUUCAUUCC | 3' | 19 | 45.8 | -49.10 | 0.96 | + | + | + | + | + | ++ | + | + |
pde-miR166b | UCGGACCAGGCUUCAUUCC | 3' | 19 | 48.8 | -43.40 | 1.01 | + | + | + | + | + | ++ | + | + |
pde-miR169a | CAGCCAAGGAUGACUUGCCUAa | 5' | 21 | 58.3 | -48.80 | 1.14 | + | + | + | + | + | |||
pde-miR171a | UGAUUGAGCCGUGCCAAUAUC | 3' | 21 | 55.2 | -55.20 | 1.28 | + | + | + | ++ | ++ | ++ | + | |
pde-miR390a | AAGCCCAGGAUGGAUAGCGCC | 5' | 21 | 53.7 | -40.50 | 0.92 | + | + | + | + | + | ++ | ||
pde-miR396a | UCCCACGGCUUUCUUGAACUUa | 5' | 21 | 55.1 | -43.28 | 0.90 | + | + | + | + | + | + | ||
pde-miR482a | UCUUUCCUACUCCUCCCAUUCC | 3' | 22 | 52.3 | -60.90 | 0.98 | + | + | + | + | ++ | + | ++ | |
pde-miR482b | UCUUCCCUAUUCCUCCCAUUCC | 3' | 22 | 52.1 | -60.30 | 1.04 | + | + | + | + | + | ++ | ||
pde-miR482c | GGCUUGCGAGGGUAGGAAAAGa | 5' | 21 | 48.9 | -45.20 | 0.90 | + | + | + | + | + | |||
pde-miR482d | CCUUUCCAACGCCUCCCAUGCCa | 3' | 22 | 54.8 | -46.50 | 0.76 | + | + | + | + | + | + | ||
pde-miR783 | AUUCUUUGCUGGUUCAUUUUC | 3' | 21 | 57.0 | -26.80 | 0.67 | + | + | ||||||
pde-miR946a | CAGCCCUUCUCCUAUCCACAA | 3' | 21 | 59.3 | -71.50 | 1.02 | + | + | ++ | |||||
pde-miR947 | CAUCGGAAUCUGUUACUGUUUC | 3' | 22 | 48.7 | -70.70 | 0.94 | + | ++ | + | |||||
pde-miR949a | UCUCUAGGAAUCAAAUGUGUCa | 5' | 21 | 47.7 | -41.80 | 0.91 | + | + | ||||||
pde-miR949b | UCUCCGGGAAUCCAAUGCGCC | 5' | 21 | 46.3 | -66.30 | 1.12 | + | ++ | ||||||
pde-miR950a | UCUGGUCCACGGUGGUUUAUa | 5' | 20 | 57.2 | -40.90 | 1.05 | + | + | + | + | ||||
pde-miR951 | UGUUCUUGACGUCUGGACCAC | 5' | 21 | 54.8 | -43.00 | 0.83 | + | ++ | + | |||||
pde-miR952a | AACAGAGCAUGCCAUUGGUGa | 5' | 20 | 54.0 | -232.79 | 0.96 | + | ++ | ||||||
pde-miR952b | AACAGAGCAUGCCAUUGGUGa | 5' | 20 | 53.9 | -214.40 | 0.99 | + | ++ | ||||||
pde-miR952c | AACAGAACAUGCCAUUGGUGa | 5' | 20 | 54.2 | -192.12 | 0.90 | + | ++ | ||||||
pde-miR1310 | GGCAUCGGGGGCGUAACGCCCU | 5' | 22 | 47.0 | -35.00 | 0.80 | + | ++ | ||||||
pde-miR1311 | UCAGAGUUUUGCCAGUUCCGCC | 3' | 22 | 48.8 | -43.40 | 0.99 | + | + | ++ | ++ | ||||
pde-miR1312a | UUUGGAGAGAAAAUGGCGACAU | 3' | 22 | 62.8 | -41.50 | 0.81 | + | ++ | ||||||
pde-miR1313 | UACCACUGAAAUUGUUGUUCGa | 5' | 21 | 58.6 | -66.72 | 0.71 | + | + | + | |||||
pde-miR1314a | CCGGCCUCGAAUGUUAGGAGAAa | 3' | 22 | 56.2 | -42.30 | 0.92 | + | + | + | |||||
pde-miR1448 | CUUUCCAACGCCUCCCAUGCa | 3' | 20 | 54.8 | -46.50 | 0.76 | + | + | ||||||
pde-miR2118a | UUUCCAACGCCUCCCAUGCCUAa | 3' | 22 | 54.8 | -46.50 | 0.76 | + | + | ||||||
pde-miR2118b | UUCCCUAUUCCUCCCAUUCCUAa | 3' | 22 | 49.4 | -42.00 | 0.98 | + | + | ||||||
pde-miR3701 | UGAACAAUGCCCACCCUUCAUCa | 3' | 22 | 59.3 | -84.10 | 1.07 | + | + | ||||||
pde-miR3704a | GGUCUCGGUGGAGUUGGGAAGAa | 5' | 22 | 53.8 | -49.00 | 0.98 | + | + | ||||||
pde-miR3704b | GGUCUCGAUGGAGUUGGGAAGAa | 5' | 22 | 54.7 | -46.40 | 0.95 | + | + | ||||||
pde-miR3712 | UGUGAUCAAGAUCAGACUCCCAa | 5' | 22 | 59.4 | -15.00 | 0.54 | + | + | ||||||
0.92 ± 0.15b |