Skip to main content

Table 7 Primers used for experimental validation of intron positions

From: The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction

COSII Marker Primer sequences (5′ – 3′) P. peruvianaunique identifier Primer position in the cDNA
C2_At3g07100 ACGAACGATGTGCTGCTGGATATAC Php00a01046.06900 F-1156/1178
  AGACCCTGGGGATCTAAGCTCTCTG   R-997/1022
C2_At 2 g35920 TGCTTGCAACCAACATAGCTGAG Php00a05845.15798 F-424/446
  AAGCTCTTGTAGTGGTGTTCGAAG   R-172/195
C2_At 3 g06580 TGCTCAACTCACATGTGAGTGTGAAAG Php00a06435.16388 F-715/740
  AGCAAACCCAGATTTTGCCATAAC   R-784/806
C2_At 5 g41480 TATTCGTGCTGGTCTGGAGAGTGC Php00a02812.11168 F-836/859
  ATGATCCTTGTCATTCGCCATAGC   R-646/669
C2_At 5 g27620 ATCTACAATGGTCCGTGATGGAAC Php00a03329.12202 F-776/799
  TTCCTCTGCCTTGCAAGCTGC   R-720/740
C2_At 3 g04870 ACGCGTGCTAGTATCCAGAGG Php00a02563.10671 F-1226/1246
  TGACATGGCAAAGCCCACTAACATAC   R-954/977
C2_At 5 g60160 ACACAATGCTAATCAACGTTATGC Php00a01985.09526 F-278/297
  TCATCCACCGCGCACATTTC   R-482/505