Skip to main content

Table 3 Primers and RT-PCR conditions used to amplify tammar IFITMs

From: Evolution of vertebrate interferon inducible transmembrane proteins

Gene Forward Reverse Number of PCR cycles Annealing temperature
IFITMA1 GTGCTCTGCGCTCCCTGT AGCCATTCCCCAACAAATA 35 58*
IFITMA2 GGCTCGCAGTGCTACAGTCT AAGTGAAGAGAGGCCACACC 30 60*
IFITMB AGGAGCGCTATCCTGTGTGT CTAGGGAAGCATGCAGGTGT 35 59*
IFITM10 CCTTCAGCAGCCTCCTCAG AGTTCAGGTCAGTGGGATGG 40 58*
IFITM5 GACCTATGCGGCGAGTCCGC GAAAGGAAGGAGGGCATCTT 40 58*
GAPDH CCTACTCCCAATGTATCTGTTGTGG GGTGGAACTCCTTTTTTGACTGG 30 60
  1. Asterisks indicate that a hot start PCR was required.