Skip to main content

Table 6 Effects of SNPs located in the 5' UTR of SLC2A1, HK1 and ESR2 on predicted miRNA binding sites.

From: Polymorphism discovery and allele frequency estimation using high-throughput DNA sequencing of target-enriched pooled DNA samples

Entrez Gene ID/Ensembl ID Chromosome Position Allele Strand miRNA name miRNA sequence Free energy ΔG1 (kcal/mol)
    T (+) bta-miR-10b uacccuguagaaccgaauuugug -20.7
SLC2A1 3 110250920    bta-miR-136 acuccauuuguuuugaugaugga -22.0
    G (+) bta-miR-1249 acgcccuucccccccuucuuca -21.5
      bta-miR-2284r uuggcccaaaaguucguucggau -21.3
HK1 28 24994609 T (+) bta-miR-2465 ugagccacaguagagccuuggau -21.9
ESR2 10 78593544 A (-) bta-miR-2348 uucgggugguguggagcggcc -21.9
  1. 1Free energy: Gibbs free energy (ΔG) of the duplex structure is indicated.