Skip to main content

Advertisement

Table 3 Primers for q-PCR analysis

From: Transcriptomic analysis of Chinese bayberry (Myrica rubra) fruit development and ripening using RNA-Seq

Genes GenBank accession no. Forward primer (5' to 3') Reverse primer (5' to 3') Product size(bp)
MrSPS1 (4705) JR053938 TGTGATCCTGAAGGGTGTGG CGAAGCTCGAATGTCGTTGC 139
MrSPS 2 (9305) JR053939 TTGATGGAAAGAACAGAGCT TTTCAAGAAGATCTGAGGAT 192
MrSPS3 (19164) JR053940 AGGGAGAGGAAGCTCAGCAT GAGCAGAAATATCACTAACC 132
MrGAD 1 (113) JR053944 CCTGTATTTGGGCTTGGTA ATTTCTCATTTCGAGTTCC 182
MrGAD2 (4648) JR053945 GTTAAGAGGTTTGTCCTGT GGTTAGGTAAACTAGTCCAA 160