Skip to main content

Table 1 Predicted novel miRNAs

From: Identification of novel MiRNAs and MiRNA expression profiling during grain development in indica rice

Name Sequence Length Abundance Chromosome Location
Can_miR_01 ACGGAAAAUCAUGGCUGCACUUAA 24 26 1 Intergenic
Can_miR_03 ACUCUAUAUGAACUAAGAUCG 21 6 8 Intergenic
Can_miR_04 UUGGCUGCAUCCCGUUCUCCUC 22 7 4 Intergenic
Can_miR_05 AGCUGCCGACUCAUUCACCCA 21 30 1 Intergenic
Can_miR_06 UCUCUCUCUCCCUUGAAGGCU 21 3 11 Intergenic
Can_miR_10 UCAAUAGCGAUCAAGGCGGAC 21 3 7 Intergenic