Skip to main content

Table 5 Primers used in this study

From: The genomic basis for the evolution of a novel form of cellular reproduction in the bacterium Epulopiscium

DESIGNATION SEQUENCE (5′ TO 3′)
GprendF ATAGACGCATTAGGAGCACG
SpoIIPbegR GCTTAGCGGACTTTGTATCACC
EpuloGprF GAGAACATTGGTATTACAGGCG
EpuloGprR GCTTGCATATATCACCTCCTTG
EpuloSpoIIPF CATTGCTGTTCACCCAGGTA
EpuloSpoIIP859R GCAGTAACCTTAGACGCA
EpuloSpoIIP684F CAAAGTATGGGCTAAATGTATTGC
EpuloSpoIIPR CAAAACAACAGACATCACCG
EpuloDacFF GAGCCCCTGATTGTAACATTT
EpuloDacFR1 GGTTAATCCAAATTCACTTTCGCC
EpuloSpoVTF TTTAGTATTATCAAGAGAAAAACAGCAT
EpuloSpoVTR TGAACATTTGTCAAGATATAAATGCAA
EpuloSspC/FF CTCCAAAATAATTTAGGAATATTGTCC
EpuloSspC/FR TACACAGAAGTACCCCTTTGC
EpuloYbdMF GAGTGGTTCTTTTAGTGGCTCTG
EpuloYbdMR AACATGACCTCACACTGGCA
EpuloYyaCF GCGGTGTTTGTTGTAAGTGC
EpuloYyaCR TACACCCGAAGAATTAAGCA