Skip to main content

Advertisement

Table 2 List of primers used in this study

From: Transcriptome analysis of the honey bee fungal pathogen, Ascosphaera apis: implications for host pathogenesis

Primer name Annealing temperature (°C) Sequence
5′MAT2 58 CTGGGCGCAAATCTCCTG
DNALR1* 55 GTCATAGCAAAGGCAGT
MAT-2 F* 62 CGACAAAGCTGTGCATATC
MAT-2 R* 62 GGAGCATATTGGTAATTTGG
MAT-1 F 55 ATGTCAGCATTCGTGACAG
MAT-1 R 58 CATCGTTGGCTGAAAGAG
Actin_Aapis F 58 CATGATTGGTATGGGTCAG
Actin_Aapis R 60 CGTTGAAGGTCTCGAAGAC
Actin_Amel F 60 TGAAGTGCGATGTCGATATC
Actin_Amel R 60 GAGATCCACATCTGTTGGAA
  1. *Described previously in Aronstein et al., 2007