Skip to main content

Table 3 Sequence-specific PCR markers linked to the anthracnose disease resistance Lanr1 of Lupinus angustifolius developed in this study

From: Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

Marker Origin Primer pair Primer sequences (5’ to 3’)
AnSeq1 Candidate marker 3* AnSeq1F AATTCCACAAATTGAAAAAC
   AnSeq1R GAAGTCAATTAATTAGTATTAGTAC
AnSeq2 Candidate marker 5 AnSeq2F CTTCTTCAGAAACAAGGAG
   AnSeq2R CAGATTAATCTCTTTAGATTTTG
AnSeq3 Candidate marker 9 AnSeq3F GAATTCAGAGACAGGACTC
   AnSeq3R AGTGTTTTTTTGGTTATCTAG
AnSeq4 Candidate marker 13 AnSeq4F GAATTCTGATGTGAAACAAC
   AnSeq4R CTCCTGGCTGAGCTTTG
AnSeq5 Candidate marker 38 AnSeq5F GAATTCAGTGGAATATTTCAT
   AnSeq5R CTTAGAACCATTCAGGTATG
  1. *Candidate marker numbers were consistent to the candidate makers listed in Table 1 and Table 2.