Table 2 Normalized abundance (TPM) of putative novel miRNAs and their predicted targets in cucurbits
miRNA | Sequence | Number of normalized reads | Targets | ||||
|---|---|---|---|---|---|---|---|
| Â | Â | Bottle gourd | Moschata | Pepo | Water melon | Pepo | Watermelon |
miR#1 | UUCCAUCUCUUGCACACUGGA | 3 | 16 | 14 | 11 | PU022623 (ubiquitin-protein ligase) ; | WMU58406 (acetolactate synthase) |
PU061865 (unknown protein) ; | WMU41511 (unknown protein) | ||||||
PU134802 (unknown protein) | |||||||
miR#2 | UGUUGGAUCGGUAUGGCAA | 13 | 17 | 13 | 0 | PU119447 (unknown protein) ; | Â |
PU062878 (unknown protein) ; | |||||||
PU005456 (zinc finger-like superfamily protein) | |||||||
PU036654 (glycine rich protein); | |||||||
PU014282 (unknown protein) | |||||||
miR#3 | UGUGAUGAUGAGCUGCUAACA | 7 | 1 | 2 | 0 | PU057169 (glyceraldehyde-3-phosphate dehydrogenase) | Â |
PU043518 (unknown protein) | |||||||
miR#4 | UACCCUUGGCUGUCUGAGCAC | 19 | 26 | 23 | 3 | PU084326 (cytochrome c oxidase) | WMU42945 (cytochrome c oxidase) |