Skip to main content

Table 3 Example of a potential miRNA sequence alteration

From: A microRNA activity map of human mesenchymal tumors: connections to oncogenic pathways; an integrative transcriptomic study

hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC   
Sample Sequencing Reads Counts (≤1 Bases Different) Counts (0 Bases Different)
LEIO_1 ACUGGACUU - GGGUCAGAAGGC 10 0
LEIO_2 ACUGGACUU - GGGUCAGAAGGC 15 0
LIPO_1 ACUGGACUU - GGGUCAGAAGGC 25 0
LIPO_2 ACUGGACUU - GGGUCAGAAGGC 15 0
  1. The reference mature sequence of miR-422a is shown along with RNA-sequencing reads for each duplicate of one leiomyosarcoma (LEIO) and one liposarcoma (LIPO). The column denoted by " ≤ 1 bases different" reports the number of sequencing reads when allowing for a single base difference in mapping to the reference. The column denoted by "0 bases different" reports sequencing reads when allowing for no differences in mapping to the reference.