Skip to main content

Table 5 Primers used throughout this study

From: Genome-wide expression analysis upon constitutive activation of the HacA bZIP transcription factor in Aspergillus niger reveals a coordinated cellular response to counteract ER stress

Name Sequence
pNC1 ACGCGTCGACGCTGTTGAGGTTCCGGCTGTA
pNC2 GGGGTACCAATCTTCAGAGCGCGCCAG
pNC7 CCGCTCGAGGGATCTCAGAACAATATACCAG
pAOpyrG-GA5rev ACGCGTCGACCCGCTGTCGGATCAGGATTA
pNC8 ATAAGAATGCGGCCGCCTCCATACCACTTTGTGCTAG
pNC11 CCGCTCGAGGGCGCATGAGAGAGTTAGG
pNC31 CGTGACACAACATCCTCCAGCGGTGTTGTGCGACCTCCAGTGTCCGTCGCTGG
pNC32 CCAGCGACGGACACTGCAGGTCGCACAACACCGCTCCAGGATGTTGTGTCACG
phac1 CTTCTCCTACCCTAACTCCT
phac2 TCAAAGAGAGAGAGGGCA