Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Novel miRNAs discovered in B-cells, their chromosome location, mature sequence, and putative folding structure

From: Comprehensive microRNA profiling in B-cells of human centenarians by massively parallel sequencing

Temporary name Genomic location Mature sequence Fold
sRNA1 chr11:95714237–95714346 || chr11:41380469- 41380478 ATCCCACCACTGCCACCA
sRNA2 chr11:46193225-46193334 TATCCCGGACGAGCCCCCA
sRNA3 chr1:218470812-218470921 CATGTGGGCTAGTTTCAGACAGGT
sRNA4 chr15:81221792–81221896 || chr15:545116- 545175 AAGGTAGATAGAACAGGTCTTG
sRNA5 chr17:76874327-76874436 ACCTTGGCTCTAGACTGCTTACT
sRNA6 chr17:24191370-24191479 GCTCTGACTTTATTGCACTACT
sRNA7 chr9:78376641-78376750 CGCTAAACCATTCGTAGACGACCTGCTTC
sRNA8 chr11:121147952–121148061 || chr11:13287835- 13287776 GGCTGGTCCGAAGGTAGTGAGT
  1. Base-pair probabilities:
  2. Novel miRNA were predicted using the mirDeep package. The pre-miRNA sequence of sRNA1 and sRNA5 were present in two genomic locations where miRNA have not been previously predicted. The fold column was generated from mFold[30].