Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Representative IsomiRs detected in B-cells

From: Comprehensive microRNA profiling in B-cells of human centenarians by massively parallel sequencing

miRNA Sequence % Control % Centenarian
hsa-miR-21 TAGCTTATCAGACTGATGTTGAC 53.8% 52.0%
  TAGCTTATCAGACTGATGTTGA 43.3% 44.9%
  TAGCTTATCAGACTGATGTTGAA 2.7% 2.8%
  TAGCTTATCAGACTGATGTTGAT 0.2% 0.3%
hsa-miR-193b AACTGGCCCTCAAAGTCCCGCT 84.8% 88.6%
  AACTGGCCCTCAAAGTCCCGCTT 8.7% 5.9%
  AACTGGCCCTCAAAGTCCCGCTA 6.2% 5.2%
  AACTGGCCCTCAAAGTCCCGCTG 0.3% 0.3%
hsa-let-7a TGAGGTAGTAGGTTGTATAGTT 86.8% 86.9%
  TGAGGTAGTAGGTTGTATAGTTA 9.3% 9.2%
  TGAGGTAGTAGGTTGTATAGTTT 3.6% 3.5%
  TGAGGTAGTAGGTTGTATAGTTG 0.4% 0.3%
hsa-miR-148a TCAGTGCACTACAGAACTTTGT 94.3% 94.3%
  TCAGTGCACTACAGAACTTTGTC 3.9% 3.6%
  TCAGTGCACTACAGAACTTTGTT 1.3% 1.4%
  TCAGTGCACTACAGAACTTTGTA 0.5% 0.7%
  1. Some of the top isomiRs are shown with the percent contribution of each isomiR to the total read count within each group. Reference sequence is denoted in bold and isomer variation from the reference is noted with bold and underscore.