Skip to main content

Table 1 Real-time quantitative PCR (qPCR) validation of AR binding sites

From: Dose-dependent effects of small-molecule antagonists on the genomic landscape of androgen receptor binding

Genomic coordinates Binding score (MACS) Fold enrichment (MACS) Fold enrichment over negative control (qPCR) Primer sequence (forward) Primer sequence (reverse)
chr start end
negative control     TGGACCTTTACCTGCTTTATCA AGCAAGGACTAGGATGACAGAA
1 228856976 228857630 864.12 56.08 3.48 GAGGACACAACCCCATGACT AGAGCGAAACTCCGTCTCAA
2 8808594 8809289 886.86 40.25 5.60 GATGGATGGATGGATGTCTT CTGGTTTTCCAAGCTCACAA
2 237457017 237457622 633.63 26.93 8.63 GCAGGGAGGTCTTTGATCTG TCCTGAATTGGTTTGCTCAT
3 187946846 187947612 665.42 25.52 8.93 CCCATTTGGCTTCTTACTTTGT TTCCTTCCTGACTCCCACTG
4 175441647 175442310 986.29 39.85 23.03 CCAAAATATCATGTGCAATCAA AAACACAATGCAAGAGGAACA
6 35699525 35700397 855.76 36.81 8.01 CGCATAGAAGCTAAGGGGAAAT GATGTGAATGCAAGCCTGTC
6 43721200 43721909 1211.19 40.99 20.88 TGGCCTCTGTCTTTTGTGTT CACAGCTTCCAACTAGCTTTACA
9 82188374 82188956 532.18 26.96 9.22 GTTGCGGGAGGAGAGTTTTA GAAGCAGGGAGACGGAGAAA
10 3852210 3852832 500.44 29.26 12.13 CACCAGCTCCCAACTTTCAG CAGCTTCCACTCCCTGTACC
19 51353679 51354605 3100 94.82 42.11 GTGTTGCTGTCTTTGCTCAG CAGTGTTGGGAGGCAATTCT
20 35888865 35889525 511.25 27.54 3.10 GCAAGACCCCATCTCAAAGA GGCTCGGCTACACTTCATTC
20 56260437 56261119 1605.03 60.05 35.60 CTGGCTGCTCCAGAGAACTA CGGCCACGTACAGTCCTATT
  1. 12 AR binding sites identified from ChIP-Seq were tested for enrichment by real-time quantitative PCR. Reactions were carried out in triplicate. Negative control refers to a non-enriched region (a region in gene desert on chromosome 12).