Skip to main content

Table 3 NBS-LRR and FIDEL sequences used for expression analysis using qRT-PCR

From: Global transcriptome analysis of two wild relatives of peanut under drought and fungi infection

Gene/Sequence abbreviation Primer sequence Forward/Reverse Amplicon size (bp) PCR efficiency (%) Regression coefficient R2
RGA11 GGCAAAGGTGATGCTACCTG/ 160 95.86 0.996
TTCCCAAGGAAGTTGATCCT
RGA122 TTGCACCAACTTCTGGTTTG/ 156 94.41 0.979
CAATGATATGCCCCGTCTCT
RGA156 TCTAGAAAGCGAGGAGCTCAA/ 157 96.09 0.991
TGGATTGACTGGGATATGCTC
RGA256 AGCTTCACGGTGAGGAAGAA/ 178 93.09 0.981
ATTCCGTGTTGCAGAACCTC
RGA390 CAGAACAACGAGAACAATCG/ 150 104.76 0.999
TTACCGTCATCCGAAACTTG
FIDEL197 TGGCTACATCCCATCCTCTC/ 167 113.25 0.994
GGGATTGAATGACTGTGACG
FIDEL274 AGCTTTTTGCTTCGGAACAG/ 161 95.92 0.903
GGGTCACAGCCAAGACTCAT
FIDEL412 GAGTTAAACGCCAGCTTTGG/ 183 95.25 0.999
CGGCGTTGGAAAGTAGACAT
FIDEL496 GCAAGCTCGTGTAGGGTTTC/ 157 110.58 0.997
GCGTTAGTGACAGACGCAAA
60S* TGGAGTGAGAGGTGCATTTG/ 155 102.36 0.998
TCTTTTGACGACCAGGGAAC
ACT1* TGGTCTCGGTTTCCTGAGTT/ 114 94.13 0.995
  AATACCACTCCAAAGCAAACG    
  1. * Primer pair previously described [42].
  2. NBS-LRR and FIDEL sequences differentially expressed in silico between A. stenosperma inoculated with C. personatum or A. duranensis drought-stressed and their respective controls.