Skip to main content

Table 5 Primers used in this study

From: High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide analysis

Primer Sequence (5’- 3’)
ccpAmut1 ATAATATCTAGAACCAAGTATACGTTTTCATC
Accout ATAATAATAGGTACCGCTTCGAGTCCGGAATC
KmkfwR ATAATAATATGTACAGATAAACCCAGCGAACCA
KmkbwR AATAATAATAATAGTATACTATAAAACATCAGAGTATGGA
tetPccpAfw ATAATAATATGTACAGCATGGTCCTAATTTTTGTT
tetPccpAbw TACTGGATACACTTATCCTTCTGCAGGCATGCAAGCTA
\