Skip to main content

Table 2 Precursors of conserved and novel miRNAs from globe artichoke

From: The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis

miRNA Sequence pre-miRNA length MFEI Accession
cca-miR156a UGACAGAAGAGAGUGAGCAC 102 1.29 JN381965
cca-miR156a* GCUCACUGCUCUAUCUGUCACC    
cca-miR156b UGACAGAAGAGAGUGAGCACA 118 0.88 GE609552
cca-miR157a UUGACAGAAGAUAGAGAGCAC 98 1.20 JN381966
cca-miR160-1 UGCCUGGCUCCCUGUAUGCCA 96 1.13 JN381967
cca-miR160-2 UGCCUGGCUCCCUGUAUGCCA 93 1.00 JN381968
cca-miR164a UGGAGAAGCAGGGUACGUGCA 83 0.99 JN381969
cca-miR166d GGAAUGUUGUCUGGCUCGAGG 86 1.12 JN381970
cca-miR166d* UCGGACCAGGCUUCAUUCCUU    
cca-miR167a UGAAGCUGCCAGCAUGAUCUGG 218 0.77 GE597437
cca-miR168a UCGCUUGGUGCAGGUCGGGAA 118 0.83 JN381971
cca-miR169a-1 CAGCCAAGGAUGACUUGCCGG 102 0.94 JN381972
cca-miR169a-2 CAGCCAAGGAUGACUUGCCGG 99 0.91 JN381973
cca-miR171a UGAUUGAGCCGUGCCAAUAUC 92 0.82 JN381974
cca-miR172a AGAAUCUUGAUGAUGCUGCAU 79 1.04 JN381975
cca-miR319c UUGGACUGAAGGGAGCUCCCU 198 1.11 JN381976
cca-miR390 AAGCUCAGGAGGGAUAGCGCC 88 1.39 JN381977
cca-miR393a UCCAAAGGGAUCGCAUUGAUCC 142 0.97 JN381978
cca-miR394 UUGGCAUUCUGUCCACCUCC 211 0.81 GE603351
cca-miR395a CUGAAGUGUUUGGGGGAACUC 80 0.97 JN381980
cca-miR395b-1 CUGAAGUGUUUGGAGGAACUC 92 1.17 JQ029164
cca-miR395b-2 CUGAAGUGUUUGGAGGAACUC 92 1.04 JQ029165
cca-miR396a UUCCACAGCUUUCUUGAACUU 119 1.38 JN381981
cca-miR396a* GUUCAAUAAAGCUGUGGGAAA    
cca-miR396b UUCCACAGCUUUCUUGAACUG 110 1.04 JN381982
cca-miR398a UGUGUUCUCAGGUCGCCCCUG 100 1.15 GE610628
cca-miR408a UGCACUGCCUCUUCCCUGGCU 107 0.70 GE605886
cca-miR399a UGCCAAAGGAGAUUUGCCCUG 83 1.12 JN381983
cca-novel-1-5p UGUCUAAGACAACUCCUUGGA 117 1.17 JN381984
cca-novel-1-3p CAAGAAGUUGUCUUAGGCAUG    
cca-novel-2 AUACGACAAAUAGAACAAAUAAAC 71 0.80 JN381985
cca-novel-3 ACGAAAACAUGUUGGUCUCACGUG 217 0.78 JN381986
cca-novel-4-5p UUGCAAGUAUCCGGAUUUAAA 210 0.78 JN381987
cca-novel-4-3p UUAAAUCCGGAUACUUGCAAC    
cca-novel-5 AAAGGGGACAAUAUCUGGUACGGU 110 1.38 JN381988
cca-novel-6 CACGAAAACAGACUGGUCUCACA 222 0.94 JN381989
cca-novel-7-1 UGAGAAGCGUAAGAAGGGAUC 157 0.88 JN381990
cca-novel-7-2 UGAGAAGCGUAAGAAGGGAUC 98 0.92 JN381991
cca-novel-7-3 UGAGAAGCGUAAGAAGGGAUC 171 0.72 JN381992
cca-novel-8 AUGGACGUGUUAUUCAUCAUGAAU 122 1.15 JN381993
cca-novel-9-5p AUCUUGUAACAUUUGAUGAUGUGG 122 1.19 JN381994
cca-novel-9-3p AUCCACGUCAUCAAAUGUUACAAG    
cca-novel-10-5p UCUUUAUGUCACGAUGUAUGAC 255 0.86 JN381995
cca-novel-10-3p CAUGCAUGGUGAUAUAAAUAGC    
cca-novel-11 GAAGUUUCAAGUGUAAAAAAGUGG 116 1.58 JN381996
cca-novel-12 UCUGAAACUCAAGAACACGUUG 81 1.06 JN381997
cca-novel-13-5p UGAAAGGAAUCAUGAACGUGA 115 0.83 JN381998
cca-novel-13-3p UCACGUCCAUUGUCCCUUUCA    
cca-novel-14 AAGCGUAAGAAGAGAUCUGAACC 157 0.80 JN381999
cca-novel-15 AUAAGGAGAGUUAAGCUGAGAAGC 184 0.72 JN382000
cca-novel-16-5p GUAAGAAGAGAUCUCCACCCUUGG 162 0.84 JN382001
cca-novel-16-3p AUCAAGGGUUCAGAUCUCUUCUU    
cca-novel-17 UAUGGUGAGAAGGGUAAGAAG 169 0.90 JN382002
cca-novel-18 UCUGGACGGUAUGCACAUGUGCAU 140 1.23 JN382003
cca-novel-19 UUCAAGAAAGCUGUGGGAAAA 124 1.34 JN382004
cca-novel-20-5p CAUGCUUGUGAUCAAAUGAUG 179 0.84 JN382005
cca-novel-20-3p UCAUUUGAUCACAAGCAUGAG    
cca-novel-21 GGUUAGGUUGAUCGGGUUGAAGAC 98 0.88 GE597304
cca-novel-22-5p UGGAAUUGGGUGCUUCGGAAGA 116 0.84 GE599895
cca-novel-22-3p UUCCGAGGCCACCCAUUCCAAC    
  1. MFEI: minimal folding free energy index