Skip to main content

Table 2 Conserved miRNAs in B. napus

From: Identification of miRNAs and their targets from Brassica napus by high-throughput sequencing and degradome analysis

miRNA miR sequence (5'→3') miR length (nt) Reads Precursor from EST Mature miRNA position Stem-loop position
  miR start miR end Precursor start Precursor end
Bna--miR159* GGGCTCCTTATAGTTCAAACG 21 79 EX039355 189 209 186 368
Bna--miR159b TTTGGATTGAAGGGAGCTCTT 21 66 EV097138 224 244 216 408
Bna-miR160a TGCCTGGCTCCCTGTATGCCA 21 4447 ES904429 153 173 149 237
Bna-miR160a* GCGTACAGAGTAGTCAAGCATA 22 7 ES904429 214 235 149 237
Bna-miR161* GCAAGTCGACTTTGGCTCTG 20 97 BZ512955 431 451 329 463
Bna-miR162a TCGATAAACCTCTGCATCCAG 21 193 DY025212 495 515 420 523
Bna-miR162b TCGATAAACCTCTGCATCCAG 21 EV208491 295 315 204 329
Bna-miR162b* GGAGGCAGCGGTTCATCGATC 21 32 EV208491 222 242 212 323
Bna-miR165a TCGGACCAGGCTTCATCCCCC 21 2205 FP063045 53 73 34 160
Bna--miR166a* GGAATGTTGTTTGGCTCGAAG 21 29 DX911364 806 826 697 831
Bna-miR166e GGAATGTTGTCTGGCTCGAGG 21 328 CU967744 48 68 39 185
Bna-miR167d TGAAGCTGCCAGCATGATCTA 21 6110 CT022223 721 741 635 758
Bna-miR167e TGAAGCTGCCAGCATGATCTA 21 AC189327 249 269 153 286
Bna-miR167e* GATCATGTTCGTAGTTTCACC 21 47 AC189327 169 189 153 286
Bna-miR167f TGAAGCTGCCAGCATGATCTT 21 160 ES910254 45 65 43 134
Bna-miR168b TTCGCTTGGTGCAGGTCGGGA 21 14 DU984956 357 377 258 396
Bna-miR169n GCAAGTTGACTTTGGCTCTGT 21 1463 CU944678 404 424 354 528
Bna-miR169n* TGAGCCAAAGATGACTTGCCG 21 11 CU944678 459 479 356 530
Bna-miR171a* AGATATTAGTGCGGTTCAATC 21 7 DX044654 128 148 119 219
     DU980843 223 243 159 246
Bna--miR171f* TATTGGCCTGGTTCACTCAGA 21 34 DU106747 666 686 647 756
Bna-miR172a GGAATCTTGATGATGCTGCAT 21 95 EV092015 731 751 637 769
Bna-miR172a* GTGGCATCATCAAGATTCACA 21 3 EV092015 654 674 629 777
Bna-miR172b AGAATCTTGATGATGCTGCAT 21 223 CU946172 157 177 69 189
Bna-miR319a GAGCTTTCTTCGGTCCACTC 20 105 ES908144 308 327 301 477
Bna-miR319b-1 ATCTGCCGACTCATCCATCCA 21 11 CN829704 153 173 76 312
Bna-miR319b-2 GAGATTCTTTCAGTCCAGTCA 21 3 CN829704 103 123 74 310
Bna-miR390d AAGCTCAGGAGGGATAGCGCC 21 1157 EE544982 541 561 471 581
Bna-miR390d* CGCTGTCCATCCTGAGTTTCA 21 348 EE544982 441 461 421 531
Bna -miR393* ATCATGCGATCTCTTCGGATT 21 30 DU101699 224 242 116 242
Bna-miR396 AATAAAGCTGTGGGAAGATAC 21 24 DU106522 54 74 35 216
Bna-miR398 TGTGTTCTCAGGTCACCCCTG 21 66 EE426846 89 109 1 123
Bna-miR399d TGCCAAAGGAGATTTGCCCGG 21 71 CX190537 106 126 9 146
Bna-miR399f TGCCAAAGGAGAGTTGCCCTG 21 62 EE556998 584 604 475 635
Bna-miR400 TATGAGAGTATTATAAGTCAC 21 25 CX189066 239 259 212 346
Bna-miR408a ACAGGGAACAAGCAGAGCATG 21 305 ES903146 59 79 49 157
Bna-miR408a* ATGCACTGCCTCTTCCCTGGC 21 141 ES903146 128 148 49 157
Bna -miR2111c TAATCTGCATCCTGAGGTTTA 21 35 BH986382 394 414 375 493
     DX056967 280 300 176 326