Skip to main content

Table 3 Candidate new brassica-specific miRNAs

From: Identification of miRNAs and their targets from Brassica napus by high-throughput sequencing and degradome analysis

miRNA miR sequence (5'→3') miR length (nt) Reads Precursor from EST Mature miRNA position Stem-loop position
  miR start miR end Precursor start Precursor end
Bna-miRC1 CCATACTAAATCTGGATCATTT 22 115 CU943501 519 540 519 634
Bna-miRC2 ATAAATCCCAAGCATCATCCA 21 1011 EV202910 179 199 173 261
Bna-miRC3 TGGGATTGGCTTTGGGCTTTTC 22 12 CU940792 108 129 82 281
Bna-miRC4 TTTCAGTCGTCATAGGTTAGT 21 11 GT084890 55 75 51 158
Bna-miRC5-1 TGTGTTGTGATGATAATCCGA 21 306 CU971106 285 305 132 350
Bna-miRC5-1* AATCGGATTATCATCACAACA 21 7 CU971106 93 113 29 291
Bna-miRC5-2 TCAACCAAATACACATTGTGG 21 4 CU971106 52 72 35 306
Bna-miRC5-3 TTATCATCACAACACTAGATC 21 536 CU971106 76 96 19 281
Bna-miRC5-3* TCTTGTGTTGTGATGATAATC 21 216 CU971106 288 308 136 349
Bna-miRC5-4 TGATAATCCGACTTCTATGAC 21 29 CU971106 272 292 122 356
Bna-miRC5-5 TTGGTTTGGATCTTGGAAATC 21 8 CU971106 123 143 42 304
Bna-miRC5-6 TCGGATTATCATCACAACACT 21 182 CU971106 89 109 27 289
Bna-miRC6 ATAGATCCTTCTGATGACGCA 21 16 DU099814 306 326 254 327
Bna-miRC7 CAAATCCTGTCATCCCTACCA 21 89 GT079632 102 122 102 229
Bna-miRC8 CAGGAGAGATTGTTGGATCCA 21 3 CU931338 337 357 337 443
Bna-miRC9 TGCCTGGCTCCCTGTATACCA 21 118 EV193539 387 407 380 474
Bna-miRC10 TCAATGTTGGCTCAATTATGT 21 12 CU934632 731 751 666 751
Bna-miRC11 GGCGAGTCACCGGTGTCGGTC 21 6 FP328714 415 435 406 534
Bna-miRC12 GGGTCGATATGAGAACACATG 21 15 EE426846 15 35 1 123
Bna-miRC13 ACCCTGTTGAGCTTGTCTCTA 21 3 CU980942 490 510 449 524
Bna-miRC14 CAGCTGGACGACTTAGTAGAC 21 7 CU943399 123 143 103 229
Bna-miRC15-1 ACATTGGACTACATATATTAC 21 8 ES901619 392 412 299 430
Bna-miRC15-2 TCAATACATTGGACTACATAT 21 9 ES901619 387 407 299 430
Bna-miRC16 GTTTTGAGAGATTGGGAAGCT 21 3 EV146378 77 97 58 216
Bna-miRC17a-1 TTTCCAAATGTAGACAAAGCA 21 7132 ES913560 96 116 31 137
Bna-miRC17a-1* CTTTGTCTATCGTTTGGAAAAG 22 782 ES913560 53 74 31 137
Bna-miRC18 TCGCGATCTTAGATCCTCTAA 21 41 EV179238 441 461 288 564
Bna-miRC19 CGAGTTGGTCGGGAAAGACGG 21 12 DU102764 104 124 35 128
Bna-miRC20 CTCTCGTGGAGCGTCTCGAGG 21 3 EV192419 700 720 567 746
Bna-miRC21 GGAGGCAGCGGTTGATCGATC 21 7 DY025212 429 449 420 523
Bna-miRC22a-1 CAAGTAGACGACTTTCCAGAC 21 10 CU945922 359 379 298 403
Bna-miRC22a-2 CGTGGTCGTCCAAGTAGACGA 21 13 CU945922 363 383 292 397
Bna-miRC22a-3 TTGGACGACTTTGTAGACGAC 21 9 CU945922 303 323 297 402
Bna-miRC23a-1 TCAGAACCAAACCCAGAACAAG 22 54 CU958057 25 46 3 241
Bna-miRC23a-2 TTACAGAACAGCAACAAGCTGT 22 150 CU958057 47 68 7 238
Bna-miRC23a-3 TATCTACTGCTTATGCCACCA 21 65 CU958057 54 74 1 215
Bna-miRC23a-3* GATGCATAACCACTAGATACG 21 8 CU958057 140 160 1 215
Bna-miRC24 TTAGGATTGAGATCTTAGCGA 21 7 EV176533 225 245 214 395
Bna-miRC25 TTGGACTGAAGGGAACTCCCT 21 23719 FP023833 319 339 168 343
Bna-miRC25* AGAGTTTCCTTAAGTCCATTC 21 34 FP023833 173 193 167 343
Bna-miRC26 TGAGCCAAAGATGACTTGTCG 21 45 BZ021311 68 88 66 323
Bna-miRC27 TAAGATGATGGAACACTGGCC 21 25 EE438385 18 38 14 279
Bna-miRC28 ATGGATCCGCCGGATAAGGAT 21 6 CU965419 466 486 350 511
Bna-miRC29 TTGAGGTTTTGAGGACTGGCC 21 6 EV093069 644 664 564 668
Bna-miRC30 TCCTGGACGACTTTCAAGTAAG 22 9 CZ888137 161 182 20 250
Bna-miRC31 AGATCATCCTGCGGCTTCATT 21 26 EV134163 290 310 233 335
Bna-miRC32 GCAAGTTGACTTTGGCTCCGT 21 51 BZ021311 52 72 13 184
Bna-miRC33 TTTTGCCTACTCCTCCCATACC 22 268 CU981257 103 124 95 223
Bna-miRC34 ATCCTCGGGACACAGATTACC 21 113 EV076017 357 377 339 459
Bna-miRC35 ATGGTGTAGGTACTGAGCAGA 21 13 EV194620 298 318 294 400
Bna-miRC36 CGTCCGGGGAAAGCAAAGTCG 21 11 EV088144 141 161 64 186
Bna-miRC37 TGATTTATCCAAGGGTTCAGG 21 31 DU101557 509 529 367 608
Bna-miRC38 CAAGTAGACTACTTTCCAGACG 22 9 GT084321 52 73 1 92
Bna-miRC39 TAAGATGATGGGACGTTGGATC 22 11 DY002174 42 63 40 306
Bna-miRC40 CGCTCACAGCATCTGAACTCT 21 21 CD842549 99 119 78 243
Bna-miRC41 TTTTGGAGAAGGCTGTAGGCA 21 13 DU109430 791 811 780 890
Bna-miRC42 TTCCCCGGACGACTTTAAATT 21 15 EV088144 90 110 3 125
Bna-miRC43 TGTGAATGATGCGGGAGATGT 21 15 CN829704 219 239 69 315
Bna-miRC44 TTGGCCACAACGGATTTAACA 21 9 EV006438 66 86 66 141
Bna-miRC45 TTTCATCTTAGAGAATGTTGTC 22 42 EV178795 578 599 478 617
Bna-miRC46 ACTTGTCTCACTCATCAGTT 20 7 EV063926 5 24 3 215
Bna-miRC47 CAAATGTAGACAAAGCAAAAC 21 4 ES913560 100 120 31 137