Table 5 miRNAs putatively targeting flavonoid biosynthetic pathway
miRNA | Sequence (5'-3') | V | M | S | H | Target (UniGene) | Score | Annotation |
|---|---|---|---|---|---|---|---|---|
miR171 | UUUUUCUGAUUGAGCCGUGCC | 17 | 51 | 19 | 6 | S_CL1522Contig1 | 5.5 | Anthocyanin synthase (ANS) |
miR858b | UUCGUUGUCUGUUCGACCUGA | 39 | 39 | 19 | 225 | M_CL545Contig1 | 4 | HTH_MYB |
miR535 | UGACGAUGAGAGAGAGCACGC | 67,950 | 30,364 | 24,750 | 51,647 | S_CL160Contig1 | 6 | Flavone synthase (FNS) |
miR166i | UGAAUGUCGUCUGGUUCGAAA | 106 | 80 | 68 | 51 | S_CL5764Contig1 | 6 | Flavonol synthase (FLS) |
miR477b | ACUCUCCCUCAAGAGCUUCUAG | 12 | 50 | 154 | 213 | H_CL379Contig1 | 6 | Dihydroflavonol-4-reductase (DFR) |
miR159e | UUUGGCUUGAAGGGAGCUCUA | 78 | 80 | 53 | 51 | V_F1XUE2F01CHQVJ | 6 | Cytochrome P450 |
| Â | Â | Â | Â | Â | Â | S_CL2652Contig1 | 6 | Cytochrome P450 |
miR172c | GUAGCAUCAUCAAGAUUCAC | 7 | 4 | 2 | 58 | H_CL3307Contig1 | 6 | Cytochrome P450 |
S_CL373Contig2 | 6 | Cinnamate 4-hydroxylase (C4H) | ||||||
| Â | Â | Â | Â | Â | Â | V_CL1167Contig1 | 6 | Cinnamate 4-hydroxylase (C4H) |
miR399 | GGGCGUCUUUCCUUUGGCAGG | 16 | 0 | 1 | 42 | S_CL3909Contig1 | 6 | Cytochrome P450 |
miR396a | CACAGCUUUCUUGAACUU | 11 | 22 | 43 | 7 | H_CL735Contig1 | 5.5 | Chalcone and stilbene synthase |
H_F09TDQC01AFYKY | 5.5 | Chalcone synthase (CHS) | ||||||
M_FJZMSUQ02GLZSQ | 6 | Short chain alcohol dehydrogenase | ||||||
S_CL831Contig1 | 5.5 | Chalcone and stilbene synthase | ||||||
V_CL2603Contig1 | 5.5 | Constitutive photomorphogenic DWARF (CPD) | ||||||
V_CL3087Contig1 | 5 | Cytochrome P450 | ||||||
| Â | Â | Â | Â | Â | Â | V_F1XUE2F01B3HEY | 5 | Cinnamate 4-hydroxylase (C4H) |
miR845e | ACCUGGCUCUGAUACCAAUUG | 84 | 387 | 63 | 947 | H_CL735Contig1 | 5.5 | Chalcone and stilbene synthase family protein |
| Â | Â | Â | Â | Â | Â | S_CL831Contig1 | 5.5 | Chalcone and stilbene synthase family protein |
miR396e | UUCCACAGCUUUCUUGAACUU | 6,309 | 13,690 | 7,655 | 2,520 | H_CL11974Contig1 | 6 | Cytochrome P450 |
miR319 | UGGACUGAAGGGAGCUCCC | 7 | 9 | 2 | 151 | M_FJZMSUQ02HT34C | 4.5 | Cytochrome P450 |
miR396b | CACAGCUUUCUUGAACUG | 20 | 39 | 62 | 22 | S_FJZMSUQ02HBX1V | 6 | Cytochrome P450 |
V_CL10716Contig1 | 6 | CPD (CONSTITUTIVE PHOTOMORPHOGENIC DWARF) | ||||||
V_CL1787Contig1 | 6 | Flavone synthase (FNS) | ||||||
V_CL2603Contig1 | 6 | CPD (CONSTITUTIVE PHOTOMORPHOGENIC DWARF) | ||||||
| Â | Â | Â | Â | Â | Â | V_F1XUE2F01B3HEY | 6 | C4H (CINNAMATE-4-HYDROXYLASE) |