Skip to main content

Table 3 List of primers used for REMAP analysis

From: Construction of the first genetic linkage map of Japanese gentian (Gentianaceae)

Primer Sequence (5→3)
LTR ISSR
REMAP1 GTAGGCACTTCAAGAATTCCACTT (AC)9T
REMAP2 GTAGGCACTTCAAGAATTCCACTT (CAC)7G
REMAP3 GTAGGCACTTCAAGAATTCCACTT (ACC)6G
REMAP4 CTAAGGGAAGCTCATAAGTTTAGGC (AC)9C
REMAP5 TACCCCTTGCCCAAGTTATCCTGT (AG)9C
REMAP6 TAGTACAACGGTAAGCGCTTGATC (AC)9G
REMAP7 TAGTACAACGGTAAGCGCTTGATC (ACC)6T
\