Skip to main content

Table 6 List of primers used for functional markers

From: Construction of the first genetic linkage map of Japanese gentian (Gentianaceae)

  Sequence (5→3)
Forward Reverse
Anthocyanin biosynthesis
CHS Chalcone synthase TGTGCAAAGTTGATTTTATTCGAC ATGTCAGAAAGGAGGGTCCAATGG
CHI Chalcone isomerase GAGTGGTTAAGCAGATGACACGAC AAGAAAATTGACAACATGCAGAAG
FHT Flavanone 3-hydroxylase TTGCACCTGAAGTAGAATTTTACA TTCTGACAGAACTTCAAGCAATTT
F3 5 H1 Flavonoid 3,5-hydroxylase TCCATTGATTAAAATGAGGGACCA TATGGTAAGTTGGGGATGTCTGAT
ANS Anthocyanidin synthase ATGTCAACTTTTTATTGGTCCTAA GAGCACAGCAAGAACTTTGGTAGC
MYB3 Transcription factor CAATGCAGCAACATTTACACTACTCCCA AAGAATCCATGAATGTAGCAGCAGCATC
bHLH1 Transcription factor AAGGTGATCGTTGTGAAAATGTCT GGCCGTCTAGTTTGGTGGTTGGTT
Flowering time
FT1 Flowering locus T CCTCAGGGAATACCTGCACTGTTT ATCCCTCTAAAGTTTAGGTGTGTTATAAG
FT2 Flowering locus T TCTTTGACTCTCTTGCTTTCTTGATGA ACCATCTTTCTACGACCGTTGCAT
TFL1 Terminal flowering 1 AAGATTATGGATTTGTACTCTTAGTCT TAACTAATGATAAGATTATGTGAAG
W14/15 Esterase CTAGTCTCTACCATTTGTCCC TCTACAAACAATGCACCTGG
\