Skip to main content

Table 1 Primers used in the first round of emulsion haplotype fusion PCR

From: Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

  Primer name Primer sequence (5’-3’)
Centromeric Emulsion PCR F1 AATGCACGCTGGTATTCTGCAA
F2’R1 TTCTCTAGCCCATCCTTGCAGGCGGGAGAGAGGTTCCAGAGTTG
R2 TGGTGTTGGCTCAGCTGGAA
Telomeric Emulsion PCR system 1 F1 TTCATTGGCCACCCTGGACT
F2’R1 TTGCAGAATACCAGCGTGCATTCCCCCTGGAAACCTCAATCC
R2 CGGGAGAGAGGTTCCAGAGTTG
Telomeric Emulsion PCR system 2 F1 TGCCTCAGTCTTCCCCAAAG
F2’R1 TTGCAGAATACCAGCCTGCATTTTACCAGACGCCACCAGTCA
R2 CGGGAGAGAGGTTCCAGAGTTG