Skip to main content

Table 2 Conserved miRNAs from common bean

From: Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing

miRNA
family
Reference
miRNA
Sequence (5'- 3') Length (nt) Reads
     LL FL RL SL Total
156 ahy-miR156a UGACAGAAGAGAGAGAGCAC 20 56 15 8 41 120
  ahy-miR156c UUGACAGAAGAGAGAGAGCAC 21 94 3512 3 317 3926
  ath-miR156a UGACAGAAGAGAGUGAGCAC 20 82529 63 3705 14478 100775
  ath-miR156g CGACAGAAGAGAGUGAGCAC 20 74 0 3 10 87
  bna-miR156a UGACAGAAGAGAGUGAGCACA 21 112 21 2 26 161
  ptc-miR156k UGACAGAAGAGAGGGAGCAC 20 47 0 6 2 55
  vvi-miR156e UGACAGAGGAGAGUGAGCAC 20 30 0 1 1 32
  zma-miR156k UGACAGAAGAGAGCGAGCAC 20 183 0 14 10 207
157 ath-miR157a UUGACAGAAGAUAGAGAGCAC 21 3114 2787 4370 4839 15110
  ath-miR157d UGACAGAAGAUAGAGAGCAC 20 361 30 26 89 506
159 aqc-miR159 UUUGGACUGAAGGGAGCUCUA 21 33 312 43 89 477
  pvu-miR159a.1 UUUGGAUUGAAGGGAGCUCUA 21 67007 1082688 180739 453692 1784126
  ath-miR159b UUUGGAUUGAAGGGAGCUCUU 21 3 438 135 178 754
  gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 0 0 1044 25 1069
  gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 78 148 202 240 668
  osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 37 224 31 148 440
  osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 57 666 298 182 1203
  pta-miR159a UUGGAUUGAAGGGAGCUCCA 20 0 3 0 25 28
160 ath-miR160a UGCCUGGCUCCCUGUAUGCCA 21 136 5160 5474 104 10874
  bdi-miR160 UGCCUGGCUCCCUGUAUGCC 20 9 212 225 5 451
  osa-miR160f UGCCUGGCUCCCUGAAUGCCA 21 9 3 240 2 254
162 ath-miR162a UCGAUAAACCUCUGCAUCCAG 21 597 583 517 1192 2889
  zma-miR162 UCGAUAAACCUCUGCAUCCA 20 14 22 15 30 81
164 ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 7245 5621 3628 1229 17723
  ath-miR164c UGGAGAAGCAGGGCACGUGCG 21 49 71 91 122 333
166 gma-miR166a UCGGACCAGGCUUCAUUCCCC 21 5333 53276 20481 15163 94253
  ctr-miR166 UCGGACCAGGCUUCAUUCCCCC 22 2 18 10 10 40
  osa-miR166e UCGAACCAGGCUUCAUUCCCC 21 0 17 8 4 29
  vvi-miR166a UCGGACCAGGCUUCAUUCC 19 93 205 166 382 846
  zma-miR166h UCGGACCAGGCUUCAUUCCC 20 140 769 352 630 1891
167 ath-miR167a UGAAGCUGCCAGCAUGAUCUA 21 661 2883 3251 90 6885
  ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 22003 1443 5196 626 29268
  bna-miR167a UGAAGCUGCCAGCAUGAUCUAA 22 2 0 17 0 19
  ccl-miR167a UGAAGCUGCCAGCAUGAUCUGA 22 2267 8164 2727 276 13434
  osa-miR167d UGAAGCUGCCAGCAUGAUCUG 21 15021 20039 6209 378 41647
  ptc-miR167f UGAAGCUGCCAGCAUGAUCUU 21 36 252 146 5 439
168 ath-miR168a UCGCUUGGUGCAGGUCGGGAA 21 382 991 605 43 2021
169 ath-miR169a CAGCCAAGGAUGACUUGCCGA 21 0 11 0 44 55
  ath-miR169b CAGCCAAGGAUGACUUGCCGG 21 1339 8784 154 6351 16628
  gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 0 4 11 0 15
  gma-miR169e AGCCAAGGAUGACUUGCCGG 20 133 47 62 316 558
  mtr-miR169c CAGCCAAGGGUGAUUUGCCGG 21 3916 166 78 2 4162
  mtr-miR169d AAGCCAAGGAUGACUUGCCGG 21 126 863 389 4 1382
  osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 1 29 1 16 47
171 ath-miR171b UUGAGCCGUGCCAAUAUCACG 21 119 790 0 37 946
  sly-miR171d UUGAGCCGCGCCAAUAUCAC 20 2 1 67 7 77
  zma-miR171b UUGAGCCGUGCCAAUAUCAC 20 28 40 13 2 83
  zma-miR171f UUGAGCCGUGCCAAUAUCACA 21 62 245 139 68 514
172 ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 43 38 24 1 106
  ptc-miR172g GGAAUCUUGAUGAUGCUGCAG 21 353 18985 200 51 19589
  sbi-miR172b GGAAUCUUGAUGAUGCUGCA 20 1 193 7 0 201
  zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 344 565 622 36 1567
319 ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 0 1672 192 320 2184
  mtr-miR319 UUGGACUGAAGGGAGCUCCC 20 21 66392 4936 40730 112079
  osa-miR319a UUGGACUGAAGGGUGCUCCC 20 0 19 5 3 27
  ppt-miR319a CUUGGACUGAAGGGAGCUCC 20 1 1622 14 106 1743
  ppt-miR319c CUUGGACUGAAGGGAGCUCCC 21 16 11934 643 3082 15675
  pta-miR319 UUGGACUGAAGGGAGCUCC 19 0 1917 201 1139 3257
  ptc-miR319e UUGGACUGAAGGGAGCUCCU 20 0 22 58 45 125
  vvi-miR319e UUUGGACUGAAGGGAGCUCCU 21 0 55 2 1 58
  vvi-miR319g UUGGACUGAAGGGAGCUCCCA 21 0 285 23 53 361
390 ath-miR390a AAGCUCAGGAGGGAUAGCGCC 21 299 1264 153 63 1779
  gma-miR390b AAGCUCAGGAGGGAUAGCACC 21 46 25 193 124 388
393 ath-miR393a UCCAAAGGGAUCGCAUUGAUCC 22 51 295 441 9 796
  osa-miR393 UCCAAAGGGAUCGCAUUGAUC 21 13 65 101 0 179
394 ath-miR394a UUGGCAUUCUGUCCACCUCC 20 71 7473 339 482 8365
  vvi-miR394a UUGGCAUUCUGUCCACCUCCAU 22 0 112 7 0 119
395 tae-miR395b UGAAGUGUUUGGGGGAACUC 20 5 25 4 8 42
396 ath-miR396a UUCCACAGCUUUCUUGAACUG 21 760 44655 10489 601 56505
  ath-miR396b UUCCACAGCUUUCUUGAACUU 21 1 185 33 16 235
  gma-miR396d AAGAAAGCUGUGGGAGAAUAUGGC 24 0 61 22 77 160
  gma-miR396e UUCCACAGCUUUCUUGAACUGU 22 0 29 6 0 35
  ptc-miR396f UUCCACGGCUUUCUUGAACUG 21 0 11 4 1 16
  vvi-miR396a UUCCACAGCUUUCUUGAACUA 21 0 23 2 1 26
  vvi-miR396b UUCCACAGCUUUCUUGAACU 20 742 19924 2108 823 23597
397 ath-miR397a UCAUUGAGUGCAGCGUUGAUG 21 2057 13 5276 70 7416
  zma-miR397a UCAUUGAGCGCAGCGUUGAUG 21 5 0 23 0 28
398 ahy-miR398 UGUGUUCUCAGGUCACCCCU 20 0 25 350 0 375
  osa-miR398b UGUGUUCUCAGGUCGCCCCUG 21 3760 57 1717 7 5541
399 ath-miR399a UGCCAAAGGAGAUUUGCCCUG 21 15 12 4 0 31
  ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 35 121 22 2 180
  osa-miR399e UGCCAAAGGAGAUUUGCCCAG 21 49 45 3 1 98
408 ath-miR408 AUGCACUGCCUCUUCCCUGGC 21 2083 3718 9050 167 15018
  bdi-miR408 AUGCACUGCCUCUUCCCUGG 20 5 25 67 0 97
  osa-miR408 CUGCACUGCCUCUUCCCUGGC 21 3 5 17 0 25
  ppt-miR408b UGCACUGCCUCUUCCCUGGCU 21 0 5 55 0 60
482 gso-miR482a UCUUCCCUACACCUCCCAUAC 21 7 318 85 2 412
  pvu-miR482 UCUUCCCAAUUCCGCCCAUUCC 22 5 291 54 0 350
1511 gma-miR1511 AACCAGGCUCUGAUACCAUG 20 978 625 449 1529 3581
1514 pvu-miR1514a UUCAUUUUGAAAAUAGGCAUUG 22 188 5481 1282 311 7262
1515 gma-miR1515 UCAUUUUGCGUGCAAUGAUCUG 22 27 853 341 86 1307
2111 ath-miR2111a UAAUCUGCAUCCUGAGGUUUA 21 48 211 255 0 514
2118 mtr-miR2118 UUACCGAUUCCACCCAUUCCUA 22 8 7 1 1 17
  pvu-miR2118 UUGCCGAUUCCACCCAUUCCUA 22 238 17300 13707 1771 33016
2119 gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 85 42 1448 6 1581
  1. Conserved miRNAs in common bean identified in leaves (LL), roots (RL), seedlings (SL) and flowers (FL).