Skip to main content

Table 3 Conserved mature-star miRNAs from common bean

From: Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing

miRNA
family
Reference
miRNA
Sequence (5'- 3') Length (nt) Reads
     LL FL RL SL Total
166 aly-miR166b* GGACUGUUGUCUGGCUCGAGG 21 233 0 5 3 241
  aly-miR166g* GGAAUGUUGUUUGGCUCGAGG 21 38 143 186 257 624
  zma-miR166a* GGAAUGUUGUCUGGCUCGGGG 21 26 3 11 7 47
  gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 36866 3839 6253 23902 70860
  zma-miR166m* GGAAUGUUGGCUGGCUCGAGG 21 55 655 50 3363 4123
167 ahy-miR167-3p AGAUCAUGUGGCAGUUUCACC 21 155 16 84 11 266
168 aly-miR168a* CCCGCCUUGCAUCAACUGAAU 21 80 22 8 3 113
171 aly-MIR171a* UAUUGGCCUGGUUCACUCAGA 21 179 710 1 543 1433
172 aly-miR172c* GGAGCAUCAUCAAGAUUCACA 21 10 352 19 1 382
390 aly-miR390a* CGCUAUCCAUCCUGAGUUUCA 21 149 524 69 10 752
  gma-miR390a-3p CGCUAUCCAUCCUGAGUUUC 20 14 3 0 2 19
396 aly-miR396a* GUUCAAUAAAGCUGUGGGAAG 21 267 306 3931 791 5295
482 gma-miR482a-5p AGAAUUUGUGGGAAUGGGCUGA 22 0 17 1 1 19
  pvu-miR482* GGAAUGGGCUGAUUGGGAAGCA 22 1185 6 440 10 1641
  1. Conserved mature-star miRNAs in common bean identified in leaves (LL), roots (RL), seedlings (SL) and flowers (FL).