Skip to main content
Figure 7 | BMC Genomics

Figure 7

From: Pause-melting misalignment: a novel model for the birth and motif indel of tandem repeats in the mitochondrial genome

Figure 7

Presumed process of M-TR motif formation in QD-07 and DS-03 of P. cornutus . a. pause of mt-replication; b. misalignment and protrusion; c. restart and extending of the N-strand; d. new type motif is generated. The blue line represents the sequences AACACT in QD-07, TTTAA in DS-03; The red line represents the sequence ATTTATCAAAATACTCAAATTTGTGGTGCCCAGGATATTTAG in QD-07, and AACACTATTTATCAAAATACTCAAATTTGTGGTGCCCAGGATATTTAGAACAC in DS-03.

Back to article page

BMC Genomics

ISSN: 1471-2164

Contact us