Skip to main content

Table 1 Genes selected for initial studies of pH regulation in T. virens

From: PacC and pH–dependent transcriptome of the mycotrophic fungus Trichoderma virens

Protein ID Sequence Function Species
40391 s ACGCCGAGACGCTCTATGAAC Transcription factor PacC T. virens, this study
as GGTGGTGCGACAAGAGTTCC
33825 s CGAGACAGACCAGGGAGAGC L-ornithine N5-monooxygenase SidA (2.5E-124) Aspergillus nidulans
as GAGTGTCGCTCAACCCATGA
43838 s GTTGGGTACAACGGCTTGGA Siderophore-transporter (9.02E-57) Aspergillus nidulans
as CAAGAAGGCGTTGGAGATGG
111866 s CCGATTTGGTGGCTTCAGAT Chitinase (0) Trichoderma harzianum
as ATTGGTGCCGACATCATTCC
67662 as ATTGGTGCCGACATCATTCC ATPase, P-type (0) Fusarium oxysporum
s GCTGACCTCCGACTGATTGAAG
87714 as GCCAGTGGCATCATCAAAGA Acid phosphatase (6.50E-95) Aspergillus nidulans
s GCCTTTGACCGCTTTGTTGT
53036 as AGTTGGGCTCAGAAGGGTGA Alpha-L-arabinofuranosidase (0) Aspergillus nidulans
s TTCGCCGAAGATGCTACGTT
59192 as ATGTGTGAACACCGCCATTG P-ATPase T. virens
s CTGGCCGTCATTCTCCTCAA
as GGGTTTCTGCCTTGACGGTA
72838 s CCAGGCACCAAGAATAAGGTCAT Xylanase (8.00E-76) Aspergillus nidulans
as GCCAGTGGATGGGTTGTAGG
76958 s GTGTCATCTGGGTCGTTGGTT Glucose permease (0) Trichoderma harzianum
as AGGGACCTGAGCAGATTCGAT
81777 s GCACCAGCAAACCGGAAGC Aspartyl protease (0) Trichoderma harzianum
as GTAACCGGTGGCAGTGAAGC
86768 s GGTCTCGGTGTCGGTTTCG High affinity sugar/H+ symporter (0) Aspergillus niger
  as GCAAGAAGCGAGGAGGATACC   
  1. Candidate genes whose expression might depend on pH and/or PacC were chosen from published studies in Aspergillus nidulans[28], Fusarium oxysporum[5] and T. harzianum[35]. A T. virens P-type ATPase (ID 59192) was already available from a differential library for transcripts expressed preferentially in cultures grown on autoclaved R. solani material. Protein ID numbers refer to the T. virens v1.0 sequence. E values (in parentheses) are from BLASTP searches of the T. virens genome with the corresponding genes indicated in the next column (species, GenBank accession).