Skip to main content

Table 2 Genes selected from microarray data for validation by qPCR

From: PacC and pH–dependent transcriptome of the mycotrophic fungus Trichoderma virens

Protein ID          Sequence Gene homology
10799 s CGACCGGCCAGGAGAGCAC regulation of pH - Na/H exchanger
as GGCTTGAACACGGGCTTGG
27509 s CCCAGAACTACCGCCTTGAA CVNH domain-containing protein
as TCAACCCAGCTACCGTCCAC
28147 s GCAAGAACATCCGCGACGAG C-type lectin
as CGCATAGCCTTCCTGAGCAT
28324 s GCCAACGAAGAACGAAGCAG Hypothetical
as CTGATCGCCCTGTCCCATAA
34827 s CCGAGTCTCTTGTTGCTGTCCTA ATPase
as TCGGAGCAGATGTTGGTGAC
56294 s CCGCAGGTGAGAATCAGAGAGT ATPase
as CGTCTTCGTCTGTCGGTGTG
68068 s TGAGGATCACTGGCATTGCTC predicted small secreted cysteine-rich protein
as GGTAGGTGGGAGATGGCACA
74915 s TTCGTCATGGAGGCTGCTG ATPase
as ACCGCAGATGACACCGAAAT
75759 s AATGATACGATGAACACACGACCT pH-response regulator protein palC
as GTGAATCTCACGGCCCGAAG
77023 s TTCCACCTCGGCAAATATGATG methyltransferase
as TCCTGGCCGTATCAATGAAGA
79497 s TCTCGTTGGTGCCTGGATTG H+/oligopeptide symporter
as CAGAGGCGACGAGGATAACG
89677 s GCGCTGATACCTACTGCCTTGA Fe2+/Zn2+ regulated transporter
as ATCGGGATCTGCAGTGTCGT
40391 s ACGCCGAGACGCTCTATGAAC Transcription factor PacC
as GGTGGTGCGACAAGAGTTCC
67662 s GCTGACCTCCGACTGATTGAAG ATPase, P-type
as GCCAGTGGCATCATCAAAGA
43392 s CCTCTGTAACCTCGATTCCAACG peptidylprolyl isomerase A [PPIA] - normalization gene
as AGCTCTGGCTCCTGGGTAGG
77851 s CGTACTACAGCCGCTACCAGACC ribosomal protein L5 [RPL5] - normalization gene
as AGGCGGTACTTGGGAGCATT
88010 s ACTTCAACGAGGCTTCTGGCAAC Tubulin - normalization gene
as CGGAACAGCTGGCCAAAGG
91925 s AGGAAGAAGTTGCTGCCCTCGTCATCGACA Actin - normalization gene
  as CCCATACCGATCATGATACCATGGTGACG  
  1. Following microarray analyses, genes were chosen based on fold change and relevance. Protein ID numbers refer to the T. virens v1.0 database.