Skip to main content

Table 1 Primers used in this study

From: Transcriptional analysis of the three Nlrp1 paralogs in mice

Name 5– 3 sequence Purpose
Nlrp1a-1F CAGAAGAGCGTCTTGAAGCAA Sequencing of Nlrp1a
Nlrp1a-F ACAGACATGGACCTCATGGTGGTT Survey of Nlrp1a expression – 201 bp [17]
Nlrp1b2-F ATGTGATGGTATGGAATTCAAAAGAACTG Survey of Nlrp1b (SV1, SV2) expression – 503 bp
Nlrp1b1-F ACACGGTAATATGGAAATGGACAGAATTG Survey of expression of all other Nlrp1b variants– 487 bp
Nlrp1c-RV ACATTTGGGGTCCTCAGTGTCACT expression – 451 bp
Actin-F TACAGCTTCACCACCACAGC beta-actin control in genomic DNA – 206 bp