Skip to main content

Table 2 Expression constructs primers

From: Intron retention and transcript chimerism conserved across mammals: Ly6g5b and Csnk2b-Ly6g5b as examples

Long primers for V5 epitope cloning in pcDNA3.1/Zeo(-)
Name Sequence
MCV5_F01 GGGGCGGCCGCATGGGAAAGCCGATCCCAAACCCTCTATTAGGTCTGGACTCCACCGGATCCTGAGATATCGGG
MCV5_R01 CCCGATATCTCAGGATCCGGTGGAGTCCAGACCTAATAGAGGGTTTGGGATCGGCTTTCCCATGCGGCCGCCCC
Primers for CSNK2B, LY6G5B and CSNK2B-LY6G5B Chimera ORFs cloning in pcDNA3.1/V5-His-TOPO
Name Sequence
HsCSNK2BORF_F01 CCCGGATCCATGAGCAGCTCAGAGG
HsCSNK2BORF_R01 CCCACCGGTGCGAATCGTCTTGAC
HsLY6G5BORF_F01 CCCGGATCCATGAAGGTCCATATGC
HsLY6G5BORF_R01 CCCACCGGTGGAAGGGTGAGGTGTC
Primers for final construct in pcDNA3.1/Zeo(-)
Name Sequence
HsCSNK2BORF_F01 CCCGGATCCATGAGCAGCTCAGAGG
HsLY6G5BORFE2_F02 CCCGGATCCGTTCCTGTTCCCGACATC
Hisx6HindIIIR_01 CCCAAGCTTTCAATGGTGATGGTGATGATG
HsLY6G5BPS_F01 GGGTCTAGAATGAAGGTCCATATGC
HsLY6G5BPS_R01 CCCGCGGCCGCTCTTTCCTACTGTGAA
  1. Restriction enzyme target sequences are in bold and italics.