Skip to main content

Table 4 Oligonucleotides used to amplify internal fragments of target genes to construct knock-out strains

From: Comparative genome analysis of Streptococcus infantarius subsp. infantariusCJ18, an African fermented camel milk isolate with adaptations to dairy environment

Name Sequence (5’ to 3’)a Name Sequence (5’ to 3’)
lacS_for GATCGGATCCGATCCAAAGCAAAATAGTCA lacS_con_for TCCTATGCAGCGGGTGCTT
lacS_rev GATCGAATTCTGCAGTCAAGATAATTGGA lacS_con_rev GAGATAATCATAAGGATAACAA
lacZ_for GATCCTGCAGGCGTTAATACAGTTGACGCTCAC lacZ_con_for TTACTTAAACGATCCAAAGA
lacZ_rev GATCGGATCCTTTGCCATGTACCGTGTGTT lacZ_con_rev CATGTTATTGGCACGATCCA
lacIIC_for GATCGGATCCAATATTTGCGAGCGATTCGT lacIIC_con_for GGAAACCATTCTTTGAGAG
lacIIC_rev GATCGAATTCTACAATTGGAGCACCGAACA lacIIC_con_rev ATTTGAAGATCCACACGTT
pORI_for TTG ATA ATG AAC TGT GCT GA pORI _rev ACG AAT CGC CAA CGT TTT CG
  1. a) Endonuclease restriction sites introduced in primers are underlined.