Skip to main content

Table 2 Primers used for qPCR analysis

From: Screening of differentially expressed genes in the growth plate of broiler chickens with Tibial Dyschondroplasia by microarray analysis

Gene Gene descriptions Primers sequence (5′-3′) Target size (bp) Tm (°C)
lox lysyl oxidase Forward: TACGTGCAGAGGATGTCCATGT 114 60
Reverse: TCTCAGGAGCACTCGGTTGTC
hsp25 heat shock protein 25 Forward: AGGAGTGTGCCCATCCAGGT 109 60
Reverse: GATGCAGACCGTTGTTCCGT
id1 inhibitor of DNA binding 1 Forward: GGGGTCATTGCCGACATT A 115 60
Reverse: AGGGGGGACTCAGGAATGTA
ktn1 kinectin 1 Forward: CGGTGAATCTTAACCAGGATGTAG 134 60
Reverse: TGCTATCCTCAGATCAGCGATT
sfrp4 secreted frizzled-related protein 4 Forward: GCTGAATCTATCTGCTGTTGGG 136 60
Reverse: CTAACACTGTAAGCATATTTCTGGC
cdh1 cadherin 1 Forward:TGAGAAGCAGATACTGAGCATTGTG 122 60
Reverse: GCTCATCTTGGCCCCTTATCTC
eno2 enolase 2 Forward: GTGTGCGTGTGTGTAGGTGTATGT 113 60
Reverse: AGTGCTCAGAACGGAAGGAAGA
rps16 ribosomal protein S16 Forward: ACAAACTGCTTGAACCTGTCCTC 127 60
   Reverse: GCTTTGGAAATAGCTTGACGG