Skip to main content

Table 2 Primer information used for quantitative real time PCR analysis of candidate genes

From: Alterations in expression of endometrial genes coding for proteins secreted into the uterine lumen during conceptus elongation in cattle

Entrez gene symbol gene name Accession number Forward primer sequence Reverse primer sequence Product length (bp)
CYR61 Cysteine-rich, angiogenic inducer, 61 NM_001034340.2 TGCAGAGCTCAGTCGGAGGGC GGCGCCGTCGATACATGTGC 111
LCAT Lecithin-cholesterol acyltransferase NM_001046069.2 CGGCCCGTCATCCTCGTGCC AAGTCCTCCGTCTTGCGGTAGCA 104
MUC13 Mucin 13, cell surface associated XM_002702427.2 ACGGGCTGGTGAGACCAAAACC GCAGTCAGCTGTCCCGTTGC 116
TINAGL1 Tubulointerstitial nephritis antigen-like 1 XM_003585097.1 CTCGGGAGGCCGGAGCGATA GTCAGGCAGCGTCTCCTCGC 81
  1. All primers were used at a concentration of 300 nM in a final reaction volume of 15 μl. A dissociation curve was included to ensure specificity of each primer pair.