Skip to main content

Advertisement

Table 2 Primer information used for quantitative real time PCR analysis of candidate genes

From: Alterations in expression of endometrial genes coding for proteins secreted into the uterine lumen during conceptus elongation in cattle

Entrez gene symbol gene name Accession number Forward primer sequence Reverse primer sequence Product length (bp)
ACTB Actin, beta NM_173979.3 CGCCATGGATGATGATATTGC AAGCCGGCCTTGCACAT 66
APOA1 Apolipoprotein A-I NM_174242.3 GCTGGCCATTGAGGTCACCCAC GCTGCCAGAAATGCCGAGCCT 103
ARSA Arylsulfatase A NM_001075205.1 GCCTTTGCCCGCGACCTCAT TGGGTGTGGTGGGAGGCGTA 80
CYR61 Cysteine-rich, angiogenic inducer, 61 NM_001034340.2 TGCAGAGCTCAGTCGGAGGGC GGCGCCGTCGATACATGTGC 111
DCN Decorin NM_173906.4 ACTCTTCAGGAGCTGCGTGTCCA GCGGGTTGGTGCCAAGTTCTACG 106
LCAT Lecithin-cholesterol acyltransferase NM_001046069.2 CGGCCCGTCATCCTCGTGCC AAGTCCTCCGTCTTGCGGTAGCA 104
MGP Matrix Gla protein NM_174707.2 GCAAAAGCCCAAGAGAGAATCCGA ACACCATGGCATAGCGTTCGCA 103
MUC13 Mucin 13, cell surface associated XM_002702427.2 ACGGGCTGGTGAGACCAAAACC GCAGTCAGCTGTCCCGTTGC 116
NCDN Neurochondrin NM_001045931.1 TCTCCAGCTCTGCAGGGGACG GGCCACGTGGGATTGCGACA 81
NMN Neuromedin N NM_173945.4 GAGCCCCCTTCAGCCTGTTCC GCCAGAAGAATCATGCACACCAGC 104
NPNT Nephronectin XM_591031.5 TCTCAGCAGCCAAAGGCCCG CTGACAGGCACAGGTCCCCT 90
NXPH3 Neurexophilin 3 NM_001192824.1 ATGACGGTCCGCCAGGCTCA CCGCTTTCGAGGCATCCGGG 80
PENK Proenkephalin NM_174141.2 GACGCCGAGGACCGCGAGAG CCATGGGGTTGCCGCTGTTCGG 120
PLIN2 Periliphin 2 NM_173980.2 TCTTCGCGCTTGGGCGTCTG CCACCCTGGTCACCACACTCAGTT 101
RPL19 Ribosomal protein L19 NM_001040516.1 GAAAGGCAGGCATATGGGTA TCATCCTCCTCATCCAGGTT 86
TINAGL1 Tubulointerstitial nephritis antigen-like 1 XM_003585097.1 CTCGGGAGGCCGGAGCGATA GTCAGGCAGCGTCTCCTCGC 81
  1. All primers were used at a concentration of 300 nM in a final reaction volume of 15 μl. A dissociation curve was included to ensure specificity of each primer pair.