Skip to main content

Table 2 Details of the SNVs studied for DAZ , GOLY , BPY2 and TTTY4 genes

From: Fate of the human Y chromosome linked genes and loci in prostate cancer cell lines DU145 and LNCaP

Target SNV Oligos used Accession no. Product size Enzyme for digestion Restriction site Fragments Alleles Present in copies DU145 LNCaP
  DAZ-SNV_I SA 770 CACAGGCACTCAGTAACTATCTC G73167 709 Fsp1 TGC/GCA 709 A 1,2,3 4 A&B A&B
398 + 311 B
SA771CAGTGTTTCACCCACCACTTCTGGGT
  DAZ-SNV_II SA 446 GACATCCACGTCATTAACAAACG G73166 182 Mbo1 /GATC 182 A 1 2,3,4 A&B A&B
122 + 60 B
SA 447 GGAAGCTGCTTTGGTAGATAC
  DAZ-SNV_III(sY586) SA 772 GTGTGGCACATATGCCTATAAA G63907 301 Taq1 T/CGA 301 A 2 1,3,4 A&B A&B
184 + 117 B
SA 773 TTGGTACATCCAGATGCAGAT
DAZ gene DAZ-SNV_IV SA 774 CTTCCTCATCTTTCTTGACTT G73168 630 AluI AG/CT 630 A 2 1,3,4 A&B A&B
398 + 262 B
SA 775 TTATTTATTCCTCAAAAAGGTG
  DAZ-SNV_V (sY587) SA 444 TGGTTAATAAAGGGAAGGTGTTTT G63908 244 DraI TTT/AAA 195 + 49 A 3,4 1,2 A&B A&B
122 + 73 + 49 B
SA 445 TCTCCAGGACAGGAAAATCC
  DAZ-SNV_VI SA 776 GGGCCTAGTCTCTAGATCATT G73169 431 AflIII A/CRYGT 431 A 1,2,3 4 A&B A
248 + 183 B
SA 777 GCTAGAACCAAATATTCTGGAT
  DAZ-SNV_VII (sY581) SA 442 CACTGCCCTAATCCTAGCACA G63906 252 Sau3AI /GATC 189 + 63 A 1,4 2,3 A&B A&B
130 + 63 + 59 B
SA 443 TCTTCTGGACATCCACGTCA
GOLY1 GOLY-SNV_1 SA768 TTGGCCTGTTGCTTCTAGGGTT BV012733 531 HhaI GCG/C 531 A 1 Copy A&B A&B
SA769 ACAGGGAGGGTGCTGTCACA 289 + 282 B 1 Copy
BPY2 BPY2 SA766 AAGCCCATTGCTGAGATACTG BV012732 470 EcoRV GAT/ATC 470 A 2 Copy A&B A
SA767 TTGTGATTCTGACCCAACGA 289 + 181 B 1 Copy
TTTY4 TTTY4 SA764 TGCAGACAGCACTGTGGCTT BV012731 541 HaeIII GG/CC 541 A 1 Copy A&B A&B
323 + 218 B 2 Copy
SA765 GTATATGGCATAATTTCACCTG