Skip to main content

Table 4 Features of sRNAs associated with transcriptionally down-regulated genes under different physiological stress conditions

From: Physiological stressors and invasive plant infections alter the small RNA transcriptome of the rice blast fungus, Magnaporthe oryzae

Gene ID/Description Condition sRNAa Microarrayb Signature Origin
MGG_01439.7 inorganic phosphate transporter PHO84 PQ 95.00 -5.04 TGGGCTCGAGAGCAAGGCG Exon sense
MGG_04470.7 nucleolar complex protein 14 NS 11.43 -1.88 TTGGCTGTGAATTCGGCG c Exon antisense
     TGGCTGTGAATTCGGCGT Exon antisense
MGG_01439.7 inorganic phosphate transporter PHO84 NS 89.5 -2.71 GGGAAGGATGGACAGGGG Exon sense
MGG_16711.7 C Hypothetical protein PQ 12.18 -1.92 AGCGTTTCTACTTTCTGATCACA Intron sense
  1. a Ratio of sRNA between particular physiological condition and CM library based on cluster data.
  2. b Expression of genes at particular physiological condition compare to CM using microarray.
  3. c This gene is selected to replace MGG_05869.6 of the annotation version6.