Skip to main content

Table 4 Features of sRNAs associated with transcriptionally down-regulated genes under different physiological stress conditions

From: Physiological stressors and invasive plant infections alter the small RNA transcriptome of the rice blast fungus, Magnaporthe oryzae

Gene ID/Description Condition sRNAa Microarrayb Signature Origin
MGG_01439.7 inorganic phosphate transporter PHO84 PQ 95.00 -5.04 TGGGCTCGAGAGCAAGGCG Exon sense
MGG_04470.7 nucleolar complex protein 14 NS 11.43 -1.88 TTGGCTGTGAATTCGGCG c Exon antisense
     TTGGCTGTGAATTCGGCGT Exon antisense
     TGGCTGTGAATTCGGCGT Exon antisense
     CGAGTCTGATGCTGAGAGCTCAGGCA Exon sense
     CGGAGAGGACGGAGAGGAGCTCC Exon sense
MGG_01439.7 inorganic phosphate transporter PHO84 NS 89.5 -2.71 GGGAAGGATGGACAGGGG Exon sense
MGG_16711.7 C Hypothetical protein PQ 12.18 -1.92 AGCGTTTCTACTTTCTGATCACA Intron sense
     AAGCGTTTCTACTTTCTGATCACA Intron sense
     AAGCGTTTCTACTTTCTGATC Intron sense
     CGGGTGCTGAGAAAGCGTT Intron sense
     GCGGGTGCTGAGAAAGCGTTTCT Intron sense
     GCGGGTGCTGAGAAAGCGTTT Intron sense
     GCGGGTGCTGAGAAAGCGTT Intron sense
     GCGGGTGCTGAGAAAGCGT Intron sense
     GCGGGTGCTGAGAAAGCG Intron sense
     TGCGGGTGCTGAGAAAGCGTT Intron sense
     TGCGGGTGCTGAGAAAGCGT Intron sense
     TGCGGGTGCTGAGAAAGCG Intron sense
     TTGCGGGTGCTGAGAAAGCGTTTCT Intron sense
     TTGCGGGTGCTGAGAAAGCGTT Intron sense
     AATTGCGGGTGCTGAGAAAGCGTT Intron sense
     GTGAAGTGATGAATACAATGCGT Intron sense
     GTGAAGTGATGAATACAATGCG Intron sense
  1. a Ratio of sRNA between particular physiological condition and CM library based on cluster data.
  2. b Expression of genes at particular physiological condition compare to CM using microarray.
  3. c This gene is selected to replace MGG_05869.6 of the annotation version6.