Identification of thyroid hormone receptor binding sites in developing mouse cerebellum

BMC Genomics

Table 2 List of TRES found in the literature

Gene	Accession #	GS	Location	TS	Sequence	Type	Ref.	TRE config.
Nr4a1	NM_010444	+	-1182 to -1218	+	actgggatggagatgtgacctgcagggtga	Neg	[22]	Trimer
c-myc	NM_019660	+	Exon1	+	cgacctaagaaggcagctct	Neg	[23]	Dimer
KLF9	NM_010638	+	-3830 to -3804	+	aggtgaagtgaggtca	Pos	[24]	DR4
UCP3	NM_009464	+	-59 to -30	+	tcagaattaggtttcaggtcagctggtgca	Pos	[25]	DR1
Myogenin	NM_031189	+	-526 to-494	+	gtggtaggtctttaggggtctca	Pos	[26]	DR4
Nas1	NM_019481	-	-436 to -425	-	aggctatagccc	Pos	[27]	IR0
MLXIPL	NM_021455	+	-2436 to-2389	+	cgggtactagagggca	Pos	[28]	DR4
MLXIPL	NM_021455	+	-2436 to-2389	+	aggcaatgagaggtga	Pos	[28]	DR4
ABCD2	NM_011994	-	-401	-	tggcctgattcgacct	Pos	[29]	DR4
CYP7A1	NM_007824	-	-3KB	-	agggca	Pos	[30]	Monomer
CYP7A1	NM_007824	-	-3KB	-	aggtcagggtca	Pos	[30]	DR0
Fgfr1	NM_010206	+	-279 to-264	+	ttgcccatttcaacct	Pos	[31]	DR4
MBP	NM_001025251	+	-184 to-167	+	acctcggctgaggaca	Pos	[9]	DR4
TRH	NM_009426	-	-57 to-51	-	tgacct	Neg	[32]	Monomer
(RAT) MBP	NM_001025289	+	-186 to-163	+	agacctcggctgaggaca	Pos	[33]	ER6

List of documented TREs in mouse genome compiled from the literature. Column description goes as follow; the gene that is regulated by the TRE, its accession number, its DNA strand (GS), the location with respect to the transcription start site of the gene, the strand of the TRE (TS), the sequence which contains the TRE with binding site in bold, the type of gene regulation that the TRE performs (up or down regulates gene transcription), the literature reference for the TRE and the TRE configuration are shown.

ISSN: 1471-2164