Skip to main content

Table 2 Priers used for qRT-PCR validation and additional expression profiling

From: Transcription analysis of the porcine alveolar macrophage response to porcine circovirus type 2

Gene Primer sequence, 5′-3′ Amplicon length, bp GenBank accession number
HPRT-1 a Forward: TCATTATGCCGAGGATTTGGA 90 DQ136030
  Reverse: CTCTTTCATCACATCTCGAGCAA   
GAPDH b Forward: TGCCAACGTGTCGGTTGT 120 NG_007073.2
  Reverse: TGTCATCATATTTGGCAGGTTT   
CD14 Forward: AGAGTTCAAAGAGTAGGGAA 86 NM_001097445.2
  Reverse: AACGCTATCTGTCCTCAC   
GPNMB Forward: CCCTCACGAGCACCCTTGT 91 NM_001098584
  Reverse: AAGAAGCCAACGAAGACCAGGAT   
ICAM1 Forward: GCAAGAAGATAGCCAACCA 106 NM_000201.2
  Reverse: TGCCAGTTCCACCCGTTC   
IFNγ Forward: AAAGATAACCAGCCCATTC 93 NM_213948.1
  Reverse: GTCATTCAGTTTCCCAGA   
IL6 Forward: CCTTCAGTCCAGTCGCCTTCTCC 97 NM_214399.1
  Reverse: GCATCACCTTTGGCATCTTCTTCC   
IL8 Forward: CACTGTGAAAATTCAGAAATCATTGTTA 105 NM_213867.1
  Reverse: CTTCACAAATACCTGCACAACCTTC   
ISG15 Forward: GGAGGGTAGGGAGGAGGGA 108 EU584557.1
  Reverse: ATGGGCGTCACACAGGCT   
S100A1 Forward: GGGAGAACAGTTGAGCAGATGGT 104 NM_006271.1
  Reverse: GGAGGGAACAGCGGGATGAA   
S100A12 c Forward: GGCATTATGACACCCTTATC 168 NM_001160272.1
  Reverse: GTCACCAGGACCACGAAT   
S100A4 Forward: GGGGAAAAGGACGGATGAAGC 96 XM_001929560
  Reverse: GCAGGACAGGAAGACGCAGTA   
S100A8 c Forward: GCGTAGATGGCGTGGTAA 155 FJ263391.1
  Reverse: GCCCTGCATGTGCTTTGT   
S100A9 c Forward: CCAGGATGTGGTTTATGGCTTTC 186 NM_001177906.1
  Reverse: CGGACCAAATGTCGCAGA   
TLR1 b Forward: TGCTGGATGCTAACGGATGTC 102 NM_001031775.1
  Reverse: AAGTGGTTTCAATGTTGTTCAAAGTC   
TLR2 b Forward: TCACTTGTCTAACTTATCATCCTCTTG 162 AB085935.1
  Reverse: TCAGCGAAGGTGTCATTATTGC   
TLR3 b Forward: AGTAAATGAATCACCCTGCCTAGCA 112 DQ647698.1
  Reverse: GCCGTTGACAAAACACATAAGGACT   
TLR4 b Forward: GCCATCGCTGCTAACATCATC 108 AY535422.1
  Reverse: CTCATACTCAAAGATACACCATCGG   
TLR5 Forward: CTCGCCCACCACATTA 156 FJ668383
  Reverse: TGAGGGTCCCAAAGAGT   
TLR6 b Forward: AACCTACTGTCATAAGCCTTCATTC 95 NM_213760.1
  Reverse: GTCTACCACAAATTCACTTTCTTCAG   
TLR8 b Forward: AAGACCACCACCAACTTAGCC 105 NM_214187.1
  Reverse: GACCCTCAGATTCTCATCCATCC   
TLR9 b Forward: CACGACAGCCGAATAGCAC 122 AY859728.1
  Reverse: GGGAACAGGGAGCAGAGC   
TNFα Forward: TGGTGGTGCCGACAGATGG 102 EU682384.1
  Reverse: GGCTGATGGTGTGAGTGAGGAA   
VCAM1 Forward: TCAGGGAGGACACAAAGAAGGG 135 NM_213891.1
  Reverse: AAACGGCAAACACCATCCAAAGT   
  1. a from reference [21], b from reference [22], c from reference [9].