Skip to main content

Table 1 Summary information on identified RAYTs and their cognate REP elements in sequenced fluorescent pseudomonads

From: Evolution of REP diversity: a comparative study

  RAYT/REP symbol RAYT accession number Cognate REP sequence
Orthogroup I PF1 YP_002873491 (P. fluorescens SBW25) GTGGGAGGGGGCTTGCCCCCGAT
PF2 n.a. GTGGGAGGGGGCTTGCTCCCGAT
Orthogroup II PF3 n.a. GTAGGAGCyGGCTTGCCrGCGAA
PF4 EJM82571 (P. sp. GM60) GTAGGAGCCGGCTTGCTGGCGAT
Orthogroup III PF5 EJN28792 (P. sp. GM80) GTGGyGAGGGGATTTATCCCCG
PF6 n.a. GTGGCGAGGGGGCTTGTCCCCCG
PF7 EJM60273 (P. sp. GM49) GTGGCGAGGGGGCTTGCCCCCG
Orthogroup IV PF8 EIK66912 (P. fluorescens Q8r1-96) GTGGGAGCGAGCTTGCTCGCGAT
PF9 EKA23398 (P. fluorescens BBc6R8) GTGGGAGCGGGCTTGCTCGCGAA
PF10 EJM47370 (P. sp. GM33) GTGGGAGCGAGCyTGCTCGCGAA
PF11 n.a. GTAGGAGTGAGCCTGCTCGCGAT
PF12 YP_006323329 ( P. fluorescens A506) GTGGGAGCTGGCTTGCCTGCGAT
PF13 n.a. GTGGGAGCGGGCTTGCCCGCGAT
PF14 ZP_10622153 (P. sp. GM78) GTGGGAGCTGGCTTGCCAGCGAT
PF15 EJM57603 (P. sp. GM41 (2012)) GTGGGAGCCAGCCTGCTGGCGAT
PF16 EJM16763 ((P. sp. GM21) GTGGGAGCTAGCCTGCTAGCGAT
NO * PF17 YP_002871781 (P. fluorescens SBW25) GTGGCGAGGGAGCTTGCTCCCGCT
NO * PF18 ZP_10436910 (P. extremaustralis 14–3) GTAGGAGCGAGCyyGCTCGCGA
NO * PF19 YP_004351241 (P. brassicacearum NFM421) GTrGGAGCAAGGCTTGCCCGCGAT
NO * PF20 EJM39110 (P. sp. GM33) GTAGGAGCTGCCGAAGGCTGCGAT
NO * PF21 EIM18788 (P. chlororaphis O6) GTAGGAGCGAGGCTTGCCCGCGA
NO * PF22 YP_002873800 (P. fluorescens SBW25) GTrGTGAGCGGGCTTGCCCCGCGCT
  1. REP sequences are denoted in 5´ to 3´ orientation as follows: conserved tetranucleotide in bold and italics, complementary (palindromic) nucleotides underlined, variable nucleotides (IUPAC code) in lower case.
  2. * NO – no orthologous RAYT genes flanked by differing REPs were detected.
  3. n. a. – protein not annotated (see Additional file 1 for these sequences).
\