Skip to main content

Table 2 Summary information on identified RAYTs and their cognate REP elements in sequenced stenotrophomonads

From: Evolution of REP diversity: a comparative study

  RAYT/REP symbol RAYT accession number Cognate REP sequence
Orthogroup I SM1 YP_001970973 (S. maltophilia K279a) GGTGG GTGCCGACCGTTGGTCGGCAC
SM2 YP_002708831 (S. sp. SKA14) GGTGG GTGCCAACCTTGGTTGGCAC
SM3 YP_006183766 (S. maltophilia D457) GTAGwTGCCAACCTTGGTTGGCA
Orthogroup II SM4 YP_002706198 (S. sp. SKA14) GTrG ATCCACGCCATGCGTGGAT
SM5 n.a. GTAG AGCCACCCCATGGGTGGCT
Orthogroup III SM6 n.a. GGTAG AGTCGACTGTTAGTCGACT
SM7 n.a. GTAG mGCCGGGyTCTrCCCGGCk
NO * SM8 YP_001972572 (S. maltophilia K279a) GGTAG TGCCGGCCGCTGGCCGGCA
NO * SM9 YP_002030358 (S. maltophilia R551-3) TGTAG AGCCGAGCCCATGCTCGGCT
NO * SM10 YP_002029847 (S. maltophilia R551-3) GGTAG CGCCGGGCCATGCCCGGCG
NO * SM11 YP_004793143 (S. maltophilia JV3) TGTAG AGTCGAGCCATGCTCGACT
NO * SM12 n.a. GTAG AGTCGAGCTTGCTCGACT
NO * SM13 n.a. GTAG AGCCGACCGTTGGTCGGCT
  1. REP sequences are denoted in 5´ to 3´ orientation as follows: conserved tetranucleotide in bold and italics, complementary (palindromic) nucleotides underlined, variable nucleotides (IUPAC code) in lower case.
  2. * NO – no orthologous RAYT genes flanked by differing REPs were detected.
  3. n. a. – protein not annotated (see Additional file 1 for these sequences).