Skip to main content

Table 2 PCR Primers designed on conserved regions of TMP for subcluster mycobacteriophages

From: Phage cluster relationships identified through single gene analysis

Sub-cluster Forward primers Reverse primer Product length
A1 CYGCYGGTAACTTCGGCTCG CTGGGCYAGCGTCTTCTGC 704
A2 SCAGGGYCTGATCAACGGC AGGAACTGCTTSCCAGTCGC 597
A3 CSTTCAACTTCAACTTCG AAGATGAACTGCTCRCC 512
A4 GGTCACGCCGCTKATCTCC CCGCCGAGTTCCTTCAGC 588
A5 GATCATCCCGTTCACCGTGG CRGAGCCGAACGACGGCAGG 248
A5 SASCTCGAAGCCAAGATCCC CRGAGCCGAACGACGGCAGG 849
A6 ACATCGCAARCGCCATCG TTGATGCCKCCGAGGAAGC 829
B1 AAAGGTGATCGTGCCCATCG GAACCTCGTGAACAGGTCGG 493
B3 CGGAACAARAAGAAGGGCGG AKGGGCAYACCGCCGACGCC 205
D CTGGGTGTAGCGGGGTCG CCTGTTCGGCGTTCTTCTGG 301
E CCAGTCGTCGCAGAACATCC CTGYGCGACRTTGCGGAGG 736
F1 TGTCGGGGTATGAGGGTGC GRCCCTGCTTCACCCCACC 303
F2 CCCCCCTGCCACTGTTCC TTGWAKCCCCGCTTGAACC 873
G GGCGTCGTCTGGGGATGG GAGATTGCCGAGCCGATGC 431
H GGCGGGTTSCTCGCVCTSC CATCCACCGCATGAGRTTRCC 632
I1&2 CTGCGSKCCCTGCAGTTCG GAACTCTTTSAGCGCGTCG 379
K GGCGTGGGWGTCGATACAGC GMCCCAGACGATTTGCGTGC 298
GGL TATGGTGCCGACGCTTGG GCCAACGMCAAACCGAGC 317
N GCGATCCCGYATGTCRACGC CGATGACGTCGTTGCGKGCC 430
  1. Primers sequences are 5′ to 3′ and the product length indicates the predicted basepair PCR product when using the primers on the indicated phage subcluster. Primers were designed using Genious software in regions of high subcluster sequence similarity with three or fewer degenerate bases.